header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13713
Transcript Name: clul1-201
Previous Name: clul1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032176 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032176|OTTDARG00000024570|ZDB-GENE-031118-57 clul1|OTTDARP00000026108 CH211-212M21.4-001 LG_ BX927088.11 Danio rerio protein_coding NOVEL, 2055 bp
CAATCACACAAGACATCAAGCGGACATTTCTGATGGTGAG
GATGAGGGTGTTGATCTTCTCTCTGGTTTTCCTGGCGTCT
CTGGGCGTCTTCCATTGTGCTCCTGAAACGTCCCTTCCTC
CAGTATTACCCAACACCCTCAAACGTCTGTCTCTGGAGGG
AGAGAAGCTGGTGGATCAGGAGGTCAGCAAAGCTCTGTAT
GGAATCAAACAAATGAAGGAGGTGATGGCCAGAAATGAAG
AGAAACATGCAAACCTAATGAAGTCCCTGAGGCACAGCGA
GGAGAAGAAAAAGGGGGCAGCAGAGATCACGCAGAGCATA
GAACAGAAGCTGAATGAAGCAGCGCAACACTGTAACGAGT
CTATCAAGTCCTCGTGGCTGCAGTGTCTGCACTGTCTCAA
CGACACCTGCAAAACCTTCTACACCAACAACTGCCGTCGT
GGATTCACCACTTTCACTAACAAACTACAGACCTTCTTCC
AGAGACTGAACTCTCAGTTTGAGCCTCGTGATGCTCAGGA
TGAGGTGGCTCTGAACCAGAGCGTTGAGACTCCTGACCTG
CAGGTGGTGAGGATCGAGGACTCCTTTAGCAGCCTTCTCT
CTAAAGTGGGAGCGCTGGTAAATCGCAGTGTGGTGCTGGT
CTCTCACTTCCACCATGAGCTAGACCAGGCCTTGCGTAGA
GCCTTCAGCCCTGAGCTTCAGGACGACCGAGAGAGAGAGC
TGCAGCTCAAGCCTAAAAACAAAGCTCTGGACTCTGCCTT
TCTGGAGGGTGTGGGTCTGGACGATGTGCTCGACTCCTTC
TTTGACTTTGGCAGACGTGTGTTGGATGAGTTTGGCGCTG
TCGTTACACAGGCTTTCAGTGACATTCATGGGGCTGCGGA
GAAGACTGGGGAAGGGAAGAAGCTCCTCCCTCAGTTTCTG
CAGACCCGGAGGCTGTGCAGAGACATGCGCAGACAGTCCT
CGGGTTGCTGGCAGCTGCAGGACAAATGTGAAGTCTGCCA
GGGAGTCTTGCTTACCGAGCCAGAATGCCCGCTTGTCAAA
GAGCTGCACATTGAGCTGGACGAGGCGTCTCAGCTGTGGG
AAGTGTCCAAGCAGCAGTATGAAGAGGTGCTGGGCATCGT
GCAGCATCACACCGAAGACACCATCAGCCTGATCAGCAAC
ATGGCCTCTGACTTCGGCTGGGTGGCCGAACTCGCCAGTA
ACAACACCACTCCTGAGAACATCTTCAACATTGCCACGGT
GGTGGCACAGACTGAAGAGGGCGCCAGCGGTCCAGCAACA
GACTCTACAGTGGAAGTGAATATCCTCAACTCCCCGACTC
TCACCCTGACCGTTCCTGCGGGTCTCAAGCTGCAGGATCC
TGCTTTCATCCAGTATGTGGCACAGGAGGCTCTGGGCATC
TACAAGCAGATGGTCAGGCATGATGACGTGTAATGAAACA
CAAGTCATCAGTTTTCGGCCCAGCTTTAACCAGAACACTC
TTGCAACATCCCATATCCTATAATTTAAGCATTGTGTTTT
GCTTAGAAACCGAGATACTACAAGCATTCATTAATGTTAT
CATATGGCAGGTTGCAATTTAAAACTTGTCTTGTTAATTC
ATGTAAACATTGTTAAACTAATGTAACCGCATAATCTCGT
TTATTGCATAAGCTTTTGCCTAGATAAATCATTAAACACT
AGGCCTCGGTGTGTTTATCAATCCTATGAAACACTATAAA
TGTTTATTTTATTTATGTTTAATTATGGTGCATGTTTCAA
TAGTAAATAAAATATTAATTAAAAACAGTATTAATAATGA
TAAAGTCACATAGACATAAAGTCTCATTACCTTTATTACT
CTCAGATGAAAAGCGTTGTTTCCACCAAGTCCTAGGTCAA
ATTCAATTGACCTAAATGTTCCACTGAAGAATTGACATGA
AAGCCACAAAGAGTTAAAAGCATTACGTAAAACTTTATTT
TTGACTGTACAAATTCTTCAGATTAGTAATCGTAACCAGT
TTCACAACAAATGTTCTCTTCTTTTCATTAAAACTCTCAC
CTCACAATCAGACCA

clul1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA clul1-201 2055
clul1-202 (1) 727
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clul1-201 Contained in:

OTHER clul1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032176 (1)
  • Ensembl_Trans:ENSDART00000098988 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC117659 (1) 2102bp
    CITATIONS (2)