Transcript

rdh10b-201

ID
ZDB-TSCRIPT-090929-13685
Name
rdh10b-201
Previous Names
  • rdh10b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032148 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032148|OTTDARG00000024551|ZDB-GENE-030909-7 rdh10b|OTTDARP00000026087 rdh10-001 LG_ CT027743.12 Danio rerio protein_coding KNOWN, 1785 bp
ATATTCTAGTTATTTTGCTATTAAGCATTTTTCTGCTCAC
GTCAATATTTAATAATTAATATAAATCCTGTAAATATGCG
CTCAGCCTCGTAAAGGTGTACACGCATTTGACGCAGAAGT
TTTGGTTACTTTGCATAACAGGCGGACACACGCGTGGAAA
GTTGTGAAGCCCAGTGAGTTGGAGCATATTTAAAGAGCTG
GAGCTCCTCAAAAACACATTGTTTTGGGCAGATTTCGTGG
ATGCTGAGGGGTGCAGATTTTGGTTAAACAGGGTGTTTCT
TTTATCACGTTTGCGGTTTGATTTCTTATCTAGTTTCATT
TCTTGTCGATTTAGTTTGTTTAGTTTGTCGAGTTGAAACA
CCATGAATATCGCCACCGAGTTGTTCGTGGTCACTTTTAA
AATAATCTGGTCGTTCGTACTGGCCGGTGCTAAATGGTTT
ATTCGTCCACGGGAGAAGAGTGTGGAGGGCCAAGTGTGCG
TTATTACCGGAGCTGGAAGCGGTCTCGGGCGGCTGTTTGC
GCTCGAGTTTGCCCGCAGACGAGCGACCCTTGTGCTGTGG
GACATCAACCGACAGAGTAACGAAGAAACTGCAGAGATGG
CGCGAGAAATCTACCGACAATTGAAGCCCTCCACCGGGTC
TTCAGATAGTGTTCAGGAATTGCCTCTTCTCCAGCCGAAG
GTTTACACGTATATGTGTGATGTCAGTAAACGTGAGAGTG
TGTATTTGACTGCAGAGAAGGTTCGCAGTGAGGTGGGAGA
CATTGACCTGCTTATCAACAATGCTGGAGTCGTGTCAGGA
CGACATCTTCTTGACTGCCCAGATGAGCTTATCGAAAGGA
CAATGATGGTCAACTGCCATGCTCACTTCTGGACTACAAA
GGCGTTCCTGCCAAAAATGCTGGAGCTGAATCACGGACAC
ATTGTAACTGTAGCAAGCTCCTTGGGGTTGTTTACAACAG
CTGGTGTGGAGGACTATTGCGCTAGCAAGTTTGGAGCCAT
AGGCTTTCATGAGTCTTTGAGCCATGAGCTGAAAGCAGCT
GATAAGGATGGGATAAAGATGACTCTCGTCTGTCCTTTTT
TAGTTGACACTGGCATGTTTGAAGGCTGCAAAATTAGGAA
AGAAATGGCTCCATTTTTCCCTCCACTGAAGCCAGAGTAC
TGTGTAAAACAGGCTATGAGAGCCATACTAACAGACCAGC
CAATGATCTGCACCCCTCGGGTCATGTACATGGTCACCTT
CATGAAAACTGTTTTGCCGTTTGATGCCATTGTGTGCATG
TACAAATTTATTGGGGCTGATAAGTGCATGTACCCTTTTC
TGGCTCAACGCAAGGAGTCGACGAACAACAACGAATCAAA
GACTGGAATCTAATTGGTTCTGATTGATGAATTCTGTGTA
GTTCCTCTGGAACGATGAAAGCTGTACATTTACAAGTCCT
TCCTAATGACATTTTACTGCCATCTTTTGAGATTGCAATA
ATGACTGAGTAGAGATTTAACTTTAATTATGAAATGATGT
GTTACTGTAAGATTATATAAGAAGGTCTGTCACCTATTTA
TGTGTACACATTTTATTTGTTGTGTGTTGTTGCTTTCCTT
TCAACATTCTATGACTTTGTCACTTTAGAGGTTTGATCCT
CCCAATAATGAAGTGCAATATTGAAAGTATTTCCTGTTGC
CTTTTGTGGTCTTGATGTGTTGATGATTTGGATGATGCCA
ATGATTGACATGAGATCATCAAAACATGCCATAAGTGCAT
ATTCAATAAATGATGTTCAAATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations