ZFIN ID: ZDB-TSCRIPT-090929-13673
Transcript Name: cntnap2b-202
Previous Names: cntnap2-001, cntnap2b-001, si:ch211-120f16.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032135 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032135|OTTDARG00000024542|ZDB-GENE-070912-26 cntnap2b|OTTDARP00000026079 cntnap2-001 LG_ BX927101.19 Danio rerio protein_coding KNOWN, 4126 bp
CTTTTTAAAATATACATCCCTTCTTTATTTCTGAGAGTAT
AAATTCTTTCTTCTGCTGCATTGTGCAATGTTATGTTGCC
CCCTTGTGGTCTATCATTCATCCTCTGCGTGGTGTATATT
TCTCCAGGAAAGAAGATGCTGGTATGTTGATGTATAAGGA
TCATTTACCTGTGAGTCAGGTTGTGGTTGGGGATATTTAT
CGCTCTGGATCTGAAGCCAAACTCACCGTCGGACCGCTGC
GCTGCCAAGGAGATCGTCACTACTGGAACGCTGCTTCTTT
CAACACACCTGCATCTTATCTTCATTTTCCAACCTTACAA
GCTGAGACCAGTGCTGATGTGTCCTTTTATTTTAAGACAT
CGGCTTCACACGGAGTCTTTCTGGAGAACCTGGGCAACCC
CGACTTCATTCGCCTAGAACTCAGTTCGGCATCAGTGGTG
TCGTTTTCATTTGATGTGGGCAACGGGCTGGTGGAGTTAA
GCGTTCGCTCATCTACACCCCTCAATGACGACCAGTGGCA
CAGGGTGGAGGCGGAGCGCAATATCAAGGAGGCTGTTTTG
CGAGTGGATAAGCTGTACAGGGAGGCGCGGTCAGCACCGC
CTCAGGGCCACACCCGCCTGCAGCTCTTCAGCCAGCTGTT
TGTAGGTGCTTCGGGTGGTCAGAGAGGATTTCTGGGCTGC
ATTCGATCACTAAAGGTCAATGGAGTGACCCTTGATCTCG
AGGGAAGGGCAAGGGTCACGCCGGGGGTGAAGCCTGGATG
TTCGGGCCACTGTAGTAGTTATGGGATGCACTGCCAGAAT
GGAGGAAAATGCATCGAAAAGTACAATGGATACTCATGCG
ACTGCAGTCAGACCGCCTTTGATGGGCCGTTCTGCAATGA
TGATGTTGGAGGGTATTTCGAGAGTGGGACGCTGGTGCGT
TTTGACCTGATGTCCGAGAGCAGCACTTCCTCTCCTGCAC
TAAAGGAAGGCGAGTCTGCGGTGCTGGGCATTGTGGGTAA
TCTGACGCACGAGGAGCTCAGCTTTAGCTTCAGCACATCC
AACACGCCGGCTGTCCTCATCTACATCAGCTCAAAGACAC
AGGACTACCTGGCCGTAGTGCTGAGACACAATGGTACTCT
GCAGATCCGCTATAATCTGGGTGGATTGAAAGAACCGTTT
AGCATCAGCCTAAACCATCGTAACATGGCGAACGGTCAGC
CTCATAACGTCAACATCAGCCGACAAGAAAGACTCATTCA
GCTGCAGGTGGATCATTACCCTACAGCGAGCTACACTCTT
CCTGAAGCCTCAGACACTGAATTCAACCTGGTCAAGACCA
TTTTCCTTGGAAAGGTGTTTGAAACGGGTCAGATTGATCC
GGTGTTGATAGAGCGATACAACACTCCAGGATTCGTGGGC
TGTTTGTCCAGAGTTCAGTTCAACCGGATCTCTCCTCTGA
AGGCGGCGCTCAGGACCGGCCCGTCCACTGCCTCCATACA
GGGAGTCCTGGTGGAGTCAAACTGCGGCGCGTCTCCGCTC
ACCGTCCCACCCATGTCTGCTGTTTTTGACCCCTGGCACC
CAGAGTCAGTCGGTGCTCAGTTCCCATTCAACGAGGAGCG
CATCAGTCGAGATGGAGTCAACAGAGACTCTGCAATAATC
GGAGGCATCATCGCAGTGGTGATCTTCACCATCCTCTGCA
CGCTGGTGTTTCTGGTGCGTCACATGTTCCGTCACAAGGG
CTCCTACCACACCAATGAGGCCAAAGGGGCGGAGTCTGCA
GACTGCGCCGATGCTGCCATCATCGTCAATGACCCCGCCT
TCACAGAGACCATCGACGAGAGCAAGAAGGAGTGGTTCAT
TTAGCCACACCCCCTAGGGGCGGGGCTTCACTCTCTGACA
GCAGCCCATGTGAAACGGACACTTGGCGACGTCTGGCATG
TCTGTTCTGTAATTATTTTGTAAGTGAGTACAGCACAAGG
ACTTCTGTAAGATCCCATTCATCCCATGCACACATGATGA
CAGTTTTAAACAACAACTGATGCATTTTTATCATTGCAAT
ATTTCTGATCGGATTAAAAAAAAAGATGTGTGTTCGGCGA
TCACGAATGCAGCGAATACTCCAATAGAACAAAGCGGAAT
GTGTACAGAATGCATACTTATGTTTTCCGATAATGACGTT
TGATTGTATTTAAGCGTTTCGTTGTCAGCATCTTCAGGAC
AATAATAATATATTGTAGCATGGAAATCAGCCAATGGCGT
TTCTGAATCACCCATCGATGTTCAATGCAGCACTTTTGTA
TCTCATGTTCTTTATAGTTGCCAGAATTCAGTGTTATTTA
TCTGTTTCTCCATAAGTGCTTGTTCAATCTCTACGGATAA
CATGATGCAGACGGACAGTTTAGAGGGGGTGAATGTTCTT
GAAGTGCCCCTATTTTGCTGTTAGGGTTTATAGTTTTTCT
TATTTCGTCAATCCGAGGTTAAAAAAAACACATTTTTCAT
TACCAACACTTTTTGTAGTGTCTGAAAGGGTTGGTTCAAG
GATCCAGTCTCTCTAAACCTCGCCTTTCTCAGAGCCTGCT
CTGCTCTGATTGGTCATATGACAGGTTCAGTTTGTTGTGA
TTGGTTGATCACTTACATTGCGTGTCCAAAACCAAATGCT
GTGAATTTGAGCTCCTCCTCTTCACTTGTAAACACAGTGT
TATAAACAATGTCATTAGTTTTAACATCCTCTTCTGTGCA
TGAGTTCTCCTTTTTTAAGCACAACCAAGTAGATTTGCTC
TCACAGTGCAGAAAACAACATCTTTTTGATATTAAAACCT
AAACTTTTATAGGTTGCAGCTATAGATACAGTGTTTGAGA
CTTAAATATAACAAAAAAATCTAAAATTAAACGCTTATCC
TATAATATGCACTGCTCCAGCTCTTTTTTAGTGTCTGTAA
TGGTTGGTTCAGGGATCCGGTCTCTCTAAACCCTGCCTTT
TTTGAGAGCCTGCTTTGCTCTGATTGGTCAGATGACTGGT
CCAGTCTGTTGTGATTGGTTGATAACTTACATTGCATGTC
TGAAACCTTATTCAGATTACCACTTGAGCTTTTCTTTGTC
ACTTGTAAGCACAGTGATATAAACAATGGCGGTAGTTTTA
CCATTCTAATTTGAGCATGAGTTCTCCTCCTTTTTTAAGT
GCAGAAAACAATGTCTTTTTTTTATAAAAACCCAAACTCT
TATATGGTGCAGCTATAGAAACAGTGTTTGAGACGTAAGG
ATGACAATAAAACAAAAATTAAATGTTTTTTTTCCATAAT
ATGCACTGCTCCAGCTATTTTTTTGTCTGAAATGGTTGGT
TCTAGGATCCGGTCTCTCTAAACCCCACCTTTCTGAGAGC
TGCTCTGCTCTGATAGGTCAGATGACTGGTCTGGTCTGTT
GTAATTGGTTGGTAACTTGCATTGCATGTCTGAAACCATA
TTCAGATTACCATATATCTGAATTTGAGCTATTCTTTGTC
ACTTGTAAGCACAGTGATATAAACAATGACGGTAGTTTTA
CCATCCTAGTTTGAGCATGAGTTCTCCTCCTGTTTTATGT
GCAACACACAAAAAAAACAACATCTTTTTGACATAAAAAC
CTCCTATTGGTTGCAGTTATAGTTACAGTGTTTGAGACTT
AAAGATGACAATAAACTCAAATTAAATGCAGAGCTACAGC
GTATGAAATGGTTGGTTCAAAGATCTGGCCTCTCTAAACC
CCGCCTTTTTGAGAGCCAGCTTTGCTCTGATTGGTCAGAT
GACTGCTCCAGTTTGTTGTGATTGGTGGAAAGAGTAGATT
TGCCCTCCCAGTGCAGAAAATAACATATTTTTGGGTCAAG
AACTTAACTTGTTTAGGTCTCAGCTACAGTTACAGTGTTT
AGGAGTTAAATAGGACAAAACATATACTTTTTACCAATAA
TATGTACAACACCACCTCTTTTCTTAGTGTCTGAAATAGT
TGGTTCAAGGATCCGGTGTCTCTAAAACCTGCATTTTTGA
GAGCCTGCTTTTCTCTGATTGGTCAAGACTGCTCAAGTCT
GTTTTGATTGGTGGAGAAAGTAGATTTGGGCCCAATCCCT
ATTCTACCCCTTAGCCCTTCCCCTTACCCCTACCCCTCGT
TTTGCG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cntnap2b-202 Contained in:
[BAC] CH211-120F16 (1)

Genome Resources: Vega_Trans:OTTDART00000032135 (1),  Ensembl_Trans:ENSDART00000155125 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO808138 (1) 911 nt
GenBank:AL923278 (1) 535 nt
CITATIONS (2)