ZFIN ID: ZDB-TSCRIPT-090929-1360
Transcript Name: prdm4-202
Previous Name: prdm4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000008980 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000008980|OTTDARG00000007891|ZDB-GENE-041210-131 prdm4|OTTDARP00000007753 DKEY-180P18.8-001 LG_ BX571796.10 Danio rerio protein_coding NOVEL, 2339 bp
GGATGAATGACATGAACCTCAGCCCAGTGGGCATGGACCA
GCTCAGTGTGCCTGTGAGTGCAAGTCACCTCGGCCTCCCC
ACATCCCCAACCCACAACCCTATCACCACTCCAGGCATGC
CAGTTGCTATTCCAAGCTTGGGCCCATCACTTGGGCCCCT
TCCTTCTGCGCTGTCCCTGATGTTACCCATGGGTCCTTTA
GGGGACAGAGGAGTTATGTGTGGCCTTCCAGAGAGAAATT
ATACACTACCACCTCCTCCATACCCACACTTGGAAAGCAG
CTACTTCAGACATATCCTACCAGGTATTCTGTCATATCTA
GCAGATCGTCCACCACCTCAATACATACACCCTAGCAGCC
TCAACATGGATGGCACTCTCTCTGTGTCCAACAACAACCC
TTCTGGCTTAGACCCCTATAGTGGCCCCGGTGGCCCTCTA
GAACAAGGCCTGGTGACTTTAGACACACGACAGGTCGGAG
GCCAAGCCGATCTCCACCAGGGAGGCTCTCACGAAGTCCA
GCTGGGCGCCACAGGACTAACCATGGAGTCCCGTGTGAGC
AGTCCGATGTCTCCTGACGGGATAGAGGAAGACTTAGCCA
CCATGGAGGGTGTCGTGGTGGCAGAAAGCCAACAGCAGCT
CGGCAGCAGATCTCAGACTCACGAGGGTTTAGCAGGCGTG
GACTCTTCAGGAGGTGTTATGCCTCTTCACGGAGCAGGAC
TGGAGCTCCCGGTGGTGATGGAGCAGGAACACATGGGTGG
AAGAGTAGGATCTGGCGGTACAGGAGCGGGTGGTCCCGGG
ACGCTGAGTGAAGCCTTGCATTCGGCTGGAGAACTGAACT
CTGGGGTGGTTAGTGTGGTGCTCACGGGGGCAATGCTGCC
GCAGACACAACTAGAGCGAGTATCTCTACACGGGCCTTCA
GGACTGGGACTGGAGCAGGTCAATGTGTCCGCACAAGTGT
CTCTTGGACCGGACAACAGTTTGGTACTGGTGAACTCTAC
CTTACAGCTTGAGGATTCCACATCTAATAAGGAAAATATG
GCTACTGCCTTCAACATATGGTGCACTTTATGTGAGCGGT
CTTATCCCTCAGATTGTCCTGAACATGGACCTGTCACATT
CATCCCAGACACACCCATTCAGAGCAGAGCCCGCCTCTCT
CTGCCCCGCCCCCTGTGCCTTCGCATTTCTGTCACCGATG
AGCCCATTGGTGTGTTTTCTAGAGAGTCCATACCCTCCAG
AACCTGCTTTGGGCCGATGGTTGGACAGCACTGCAGCAGT
GTGGAACTGACAGACTGGTCAGACAAGGACACCCCTCAAA
TATGGAAGATGTTTCACAACGACATCCAAGAATTCTGTAT
TGTGACGACAGATGAGCATGAATGCAACTGGATGATGTTT
GTGAGGAAAGCAAGAACTACAGGGGAGCAGAATCTGGTGG
CGTATATTGACAATGGAAAGCTGTATTTCTGCACAACCAG
AGAGATTCTGCCCGATCAGGAGCTACTGTTTTATTTCAGC
AGGGACTACAGCAGACAGCTAGGTGGGTGTTCCCAGAGTT
CCAGAGGGCCAGATCTGTCATTGTGGAAAAGAATGTGCCT
CCTTCACAGAGTTCAAATCTCACCTCGGCAGTCACGCTCA
GAGCCACACAGCAGCAGCGGTAATGGGCACGGCCGCGAGA
GGAAGTTCAAATGCAGCATGTGCACACGAGCGTTCACTAC
CTCCACTAAACTAAACGTGCATTTCATGGGTCACATGGGC
ATGAGGCCACACAAATGCAGCTACTGCAGCAAAGCCTTCA
GTGATCCCAGCAACCTCAGAAAACACCTGAGAATTCATAC
AGGTCAGAAGAACTTCAGGTGTACAGTGTGTGGGAAGTCT
TTTACTCAGAAGGCACATGTGGAATCTCATATGGTTATAC
ACATCGGTGCCAAAAACCTTAAATGTGACCATTGTGACAA
GATGTTTGTGCGAAAACAAGATCTCAAACAGCACATGTAC
TCACATTCACTAGACCGGCAGATAAACTGTCCAAAGTGTG
ACAAGCAGTTCCTAAAGCCTGACCATCTTAAAAAACACTT
AAACTCTCATGAAGGGAAGCGGGACTTCATCTGTGAAAAG
TGCAACAAGGGTTTCCTCACTAAATACCACCTCACACGCC
ACCTCAAAATCTGCAAGGGCCCAAAGATCGGCCGGGGGGC
CACACAGGGTGAGGAAGAAGAGGAGGAAGATGAAGAGGAG
GAAGAAGAAGAGGACGAAGAGAGAGAAGCTGAGATCCATC
CAGCCAATCAGGAGGAGTGTGCAATCGGAATGGGTGGTTA
TGCTTCTGAAAAAAATATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prdm4-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000008980 (1),  Ensembl_Trans:ENSDART00000147629 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)