header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13556
Transcript Name: col15a1b-202
Previous Names: col15a1b-001, col15a1b-002, ottdart00000031948, si:dkeyp-93c5.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031948|OTTDARG00000024407|ZDB-GENE-070912-689 col15a1b|OTTDARP00000025944 col15a1b-001 LG_none BX511097.21,CU467838.4,CR788285.5 Danio rerio protein_coding KNOWN, 4560 bp
CGGAGCGCCGTGTAGCACTGAGACTGAGGCAGTCTTTGTT
CAGCCACGAAGTGAGAGAGACTGGAGAGAGTCAGTCAGGA
GAACAGAAAGAGAGAGAGAGAGAGTGGGTGACAACACTCT
GGAAGTGTTGATATCCACGTTTTTGCACTAATCTCATGCT
TGGACTTTTGAACAAAAATGAAATTTCGCCTCCTGTCGTG
GCTCGTTGGTGCACATCTCGCCTTGGGTTATCTCTCCTCT
GCGCTTCATGTCATGGAAGAGCGAGGCTCCAAGGGTCACC
TAATTCTAACAGACCTCGTTGGCATGCCTCTTCCACCATC
CGTGTCCTTCATCACGGGCTACGAGGGTTACCCTGCCTAC
TCTTTTGGGCCTCATGCTAACGTAGGCCGACTGACCCAGT
CTTTCGTACCTGAGCCCTTCTTCACAGACTTTGCCATCAT
CGTCACAGTCAAACCATCTAGCTCTCGAGGAGGAGTCCTG
TTTGCCATCACAGACCCGTCCCAGACCATTGTCCAACTTG
GCCTGGCCCTGACACCCGTGGAGGACCAGACTCAGCGGAT
TGTACTGTATTACAGTGAGCCGAGGTCAGCGAACAGCGCA
GAGGTTGCGTCTTTTAAAGTGCCAGACATGACGCAGCAGT
GGAGCCGCTTCACACTGTCGGTGGAGCGCCAGGAGGTTCG
TCTCTACATGGACTGTGATGAATACCACATTGCCCCCTTC
AAGAGGAGCCAGCAGCCCCTCAGCTTCAAGCCTGGATCGG
GGATCTTTGTGGCGAATGCGGGTAGTACCGGCCTGGAGAG
ATTTGTGGGGTCAATCCAACAGCTGGTAATAAAACCTGAC
CCCAGAGCAGCAGAAGAGCAGTGTGAGGAAGACGACCCCA
GCCTGCAGGCCTCCGGGGACAGAAGTGGCGATGGTGATTA
TGATGATGAGGAAGAACATGCGAGGCGTGAAGAAACCTTT
GGGCAGACTAACAACAAGGAAAAGACACTAAGACCCACCT
CTCCTGTTGAAGCCCCACCCATTCAGTCACCTGACATAGA
AGAGGGTGGATTCTCAGGACATGTGACCCCAATAGATGAA
AGGCTGCTGAGAGGGACTTACAAAACAGATGAAACAGGGG
AGAGGGTTGGACAGAAAGGGGAGCGTGGAGAACCTGGGCC
TGCAGGGCCACCTGGACCCCCTGGGCCTCCAGGAACATCT
GTCCCAATCAGACATTCAGGACAGCCTGGACCGAGAGGAC
CACAGGGTCCAATTGGTCAGCCAGGAGGACGAGGCAGACC
AGGGAAAGATGGACAACCTGGAAGCAAAGGTGAAGATGGG
AAACCAGGTCAGAGAGGACAGACGGGACCTCCTGGATTAC
CTGGAGAATCTGGAGTCAAAGGAGAGAAGGGTGATCCTGG
AGTGGGCCGGACTGGATTGCCTGGTCCACCAGGACCTCCT
GGACCACCAGGGCCAAGCAAACCAGTTAAGGTTCCATATG
GATTTGATGCACTGGGCTCTGGATTTGGAGATGCTGACAT
TGATACAGAACTTCTTCGGGGTCCACCTGGTCCTCCAGGG
CCTCCTGGGATACCCGGCCCTCCTGGTCCTAATAGCCCAC
TTGGAGGATTGCTCCCTGGTCCTCCAGGGGCTCCTGGCAA
AGATGGCAGAGATGGGCAGAGTGGGCTCCCTGGTGTTCCT
GGTCAGGATGGCTTACCTGGACAACAGGGTCCGAAAGGAG
CAAAGGGTGAGCACGGAATTAGAGGGCCTCCTGGACCTAA
GGGTGAAAATGGAGATCCTGGTCAGAGAGGACCACCTGGC
CCTTTTGGAACGATGGGACCGAGAGGTTTACCAGGACCAC
CAGGGCCTCCGGGTCCACCAGGGCCCATAAACAATAACTT
TATGGTGGATACTTTGAAGGATTTCGAGGGTTCTGGTGAA
AGTGGTTCATTTCTCGGAACTGGAATTTTGAAAGGCTATC
AAGGGCCTCCTGGTCTTCCTGGCCCACCAGGACCTCAGGG
ACCTCCTGGTGCTAACGGACCACCTGGCTTGTCTGTAAAG
GGTGAAAGAGGATCTCCAGGACCCGATGGAATACATGGAT
TAGCTGGTTTACCAGGAGCAAGGGGACCAAAGGGAGACAA
GGGCAATCCGGGAGAAAAGGGTGAGCGAGGTCGCGATGGA
CTGAACATCACAGGTCCTCCCGGCCCCCCCGGCCCTCCTG
GACCAATCATTAACTTCCAGGACCTTTTTCTTAATGACAC
AGCTGCTAAACTGAACCTCACAAAGATCAGAGGACTGCCA
GGCCCTATGGGCCCTGAAGGCTTGCCTGGCAGAGCAGGAT
TCCCTGGCCCAAGAGGACCAAAGGGGGAAATTGGGTTTCC
TGGTGTGCAAGGACCTCCAGGACTAAAGGGGGACAAGGGT
GAGCCAGGTGTATCCATCGCTGCTGATGGCTCTATAATCA
CAAGCCTGCGAGGACCCAGAGGACCAAAGGGAACCAAGGG
AGACATTGGTCTTGCTGGCCCACATGGGATTCCGGGGCCA
ATTGGACCACCTGGACTAAAAGGGGGATATGGAATTCCTG
GTCGACCGGGTCGACCTGGAATAGCTGGAAGGAAAGGGGA
CAAGGGAGATGCAAGTGGTCCCTCTGGTCCACCAGGTCCA
CCTGGACCTCCAGGGCCACCAGGACGAGTGATTGGCCTCA
ATGGAGGTCCTAAAGGTGATAATGGCTACAATGGGCAAAA
GGGAGAGAAAGGTGATCCAGGTTTGCCTGGCCCTCCTGGA
CTTCCTGGGAGAACAGGCCTTGTTGGTCCTAAAGGGGAAT
CTATTGTTGGTCCTCCTGGAGACACTGGTGCTCCAGGACC
TCCAGGACTGCCTGGGTATGGAAGTCCAGGACCACAAGGC
CCACCAGGAGCTCCTGGCCCTCCAGGAACCTCATCACTAT
ACAGCTCAGCTGCAAGTCTCCCCGGACCTCCTGGACCTCC
AGGGCCACCTGGTGCTCCTGGCTATGGAAACCCTGTGAGC
ACATATAAAAACAGCCAGACCTTGATGAGAGAGAGCAGCC
AAGCAGCAGAAGGCACAATGGGATATGTTATTGACAAGAG
TGAACTGTACATCAGGGAGTTAAAGAGCTTTCTGCCAGGC
TATAATCTTCTTCCGGACACTACACACTCAATGCCTGCGT
TGCACTTGGTGGCTCTCAATGCCCCATTCTCAGGAGACAT
GCATGGCATCCGCGGGGCAGATTACCAGTGTTACCAGCAA
GCCAGAGCCAGAGGCCTGACATCCACATACAGAGCTTTCC
TTTCCTCTCATCTGCAAGACCTCTCCACCATCGTCAAGAA
AGCAGACCGTTTTAACTTACCGGTGGTGAATCTAAAAGGA
GAAGTGCTGTTCAGCAGCTGGATGGCCATGTTCTCTGGTA
ATGGAGGCGTTTTTGATCCACTTACTCCGATTTACTCCTT
TGATGGACGAAATGTCTTGACAGATCAGGCTTGGTCTCAG
AAGCTGGTGTGGCACGGGTCAAGTACGGTGGGCATCCGAA
TGACAACAAACTACTGCGAGGCCTGGCGGACAGGTGACAT
GGCAGTAACCGGACAGGCGTCTCTCCTTCAGACCGGCCGA
CTGCTGGGACAGCACACACGCAGCTGCTCAAACCACTTCA
TCATTCTCTGCATCGAGAACAGCTACATCCAGCACCCTGG
AAGGAACTAGAAAGCCCAACGTTTACAAGTAATTGAAAGC
AGCAGTAGCTGGACTGCTGGGGAAAATTATCCATTCTCCT
CCTTTTTAGCTCCTGGGAGAAATAACAAGCCAGGAAAAAG
CCAGGCACTGCATTGGTCTTTCACTTCTTGTCTGAGCATG
ATGTAAATATGTATAAATCACCCACTGGTATTGTTCAATT
GAAGACCCACCGACTTTCATTCAACTATTAGAAAACCAAA
GAATACCTCAGTCAGACATCTATGAGCAAGTGTAGATCCA
CTTTATGAATTCACCACATTATTTTTTTGCCTTCTAAAAA
GGTTTTAGCCCTCATTACGATCACTAATATAGCTTTGTGT
GTGTGCTTGTATTAACTACATTGTTATAACCGCACACACT
GATAGATACAAGACACTTACTTTTAATCAGATTAAATATA
TTTAGATATCAGTATTTGGGTATATTCAAACAAACGAGGG
AGATGTTTAAATGCACTGTATTAATAATTTCTTGGGTGTT
GTTATTTTATTTTTGGTTATAGTTTGTTTTGACACCCATG
AAGCTCTATTCTGTGAACTTGCATTTAAACTAGTATTTAA
GGGAGGCGATGCGTCTAATTTATGATGTTAATGCACATAA
CTAAAACCCAAGTGCATAATAGATACTGATTTAGAAAGTA
GACAATGGCCACAATCATTTATAACTCATCACTGTGTTTA
ATCTCTCACATTTAGAAAGGCAAACTAGAAAGTAAGTTAT
GTTATTTGTATCTTCTAGAAGTCAAATAGGAGTATGATAC
AGCAATAGAGAGATACCCTCGTTTTCTCCTTTTTTCAAAT
TTGAATGGTGCTCACTGAATAAATTTTTGTTTTATAAGTA

col15a1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA col15a1b-202 4560
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col15a1b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031948 (1),  Ensembl_Trans:ENSDART00000137065 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CF999994 (1) 784 bp
GenBank:CT725620 (1) 780 bp
GenBank:CT703775 (1) 779 bp
GenBank:CT614215 (1) 735 bp
GenBank:DN899386 (1) 691 bp
GenBank:CT595943 (1) 687 bp
GenBank:AI641680 (1) 517 bp
GenBank:EB961695 (1) 499 bp
GenBank:EB831185 (1) 386 bp
CITATIONS (2)