ZFIN ID: ZDB-TSCRIPT-090929-13460
Transcript Name: zgc:161973-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031830 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031830|OTTDARG00000024320|ZDB-GENE-070410-13 zgc:161973|no_translation CH211-105D4.6-002 LG_ BX897733.8 Danio rerio protein_coding KNOWN, 747 bp
TTAGCTCATTGTACTAATCATGGCTAAGCTTACTGGTCTT
AGTGAGTTTCTCAGGACTATAAGACAAGGCCTTGATCAAA
CTGAACAAACCGCTCGAGCGGAGGCTCAGAATGGTGACTG
TGTGCGAAAACGGAAGAGTCACGTGTCGAATCCTTTGCAA
ACTGAAACGAGCAAAACTGTGTTTGAAGAAAGCCCTAACA
ACTGGCAGGAAAATTATTTGGAGAGGTTGCCATCTGAGAT
CATCCTCAAGATTCTTTCCTCTCTGGATGCCTCCTCTCTG
TTCAATATCAGCTTTGTCAACAAGCGGTTTCATGATCTGG
CCAACAGCAAGTGAGTTTGTGACAGAAAGTGTATGAATAT
GGAATAATAAATATTAACATGGATGTCCAGTGCTCTGTGG
TCTGTGTTGTATGCTTCCGAGATTGAGAAGAAGAAGTGGA
GACCTCGAGTAAGTGTGGCAGAAGGCATGAGAAGCACACA
TGCGGAAGGGAAACCTTCAGGATACTGGAAGAAGATGCTG
CTCAAGGAGATGGCAGGATACAAGGACACCATGTGGAAAA
CAGAGCTAAAACACAAGAACCCACACACCGGCATGCCAGC
TCTCACTGAGGAAGTGCTCAGGAGATTACACATTCAGTGG
GAAATCACACTTACGTTTAGGAATGGACGTGAAAGTGTCT
ACAAGCAAACACACACTTTCTTTGAGGATTCATCGGTTAC
TGTGTTTTGGAGTAATGGCTGCTGGCC

zgc:161973 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:161973-201 (1)    Ensembl 1850
ncRNA zgc:161973-002 747
zgc:161973-003 (1)    Ensembl 317
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:161973-002 Contained in:
[BAC] CH211-105D4 (1)

Genome Resources: Vega_Trans:OTTDART00000031830 (1),  Ensembl_Trans:ENSDART00000123442 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CF550228 (1) 939 bp
CITATIONS (2)