header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13457
Transcript Name: zgc:161973-201
Previous Name: zgc:161973-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031827 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031827|OTTDARG00000024320|ZDB-GENE-070410-13 zgc:161973|OTTDARP00000025853 CH211-105D4.6-001 LG_ BX897733.8 Danio rerio protein_coding KNOWN, 1850 bp
ATATTCAGCCTGTTATGTTGCCCTCTAGCGAAATTATCTT
GTAAGGTCAAAGGCCAGCAGGTTAGCTCATTGTACTAATC
ATGGCTAAGCTTACTGGTCTTAGTGAGTTTCTCAGGACTA
TAAGACAAGGCCTTGATCAAACTGAACAAACCGCTCGAGC
GGAGGCTCAGAATGGTGACTGTGTGCGAAAACGGAAGAGT
CACGTGTCGAATCCTTTGCAAACTGAAACGAGCAAAACTG
TGTTTGAAGAAAGCCCTAACAACTGGCAGGAAAATTATTT
GGAGAGGTTGCCATCTGAGATCATCCTCAAGATTCTTTCC
TCTCTGGATGCCTCCTCTCTGTTCAATATCAGCTTTGTCA
ACAAGCGGTTTCATGATCTGGCCAACAGCAATGCTCTGTG
GTCTGTGTTGTATGCTTCCGAGATTGAGAAGAAGAAGTGG
AGACCTCGAGTAAGTGTGGCAGAAGGCATGAGAAGCACAC
ATGCGGAAGGGAAACCTTCAGGATACTGGAAGAAGATGCT
GCTCAAGGAGATGGCAGGATACAAGGACACCATGTGGAAA
ACAGAGCTAAAACACAAGAACCCACACACCGGCATGCCAG
CTCTCACTGAGGAAGTGCTCAGGAGATTACACATTCAGTG
GGAAATCACACTTACGTTTAGGAATGGACGTGAAAGTGTC
TACAAGCAAACACACACTTTCTTTGAGGATTCATCGGTTA
CTGTGTTTTGGAGTAATGGCTGCTGGCCATTGATGCACAA
TCTTGATAGCCTGAAGCTTCATGGAATCATGTGTCGACCT
GTGGGAGCTCCTGGAGACAAGCCGAGGTGGCGCTCTCTGA
TCTGCAAGACAGCTACAGATAAATCTGTACACTGGGTGTT
TCTTGGCTATGACAGGCTTGTGAAATTGCTGCAGTTTGGC
AAAATCATCATCGGCGTCTGGCGGGGCAACTGGAGAATCG
CGTTTATCATGATCAACCTGCACTTTCACAAACTGATTGA
AAAGAGTCTTCTTGGGTCAAGATTTTGCCCCTACATACCA
ACAGAAGACAATGCTGTGGACCCTGACTGTGTTCGGCATG
GATACACACTCCACATTGTGCTTCACAATCCAGTTCGCAG
AATCATGTGTCAGCGTTTCTCCCCACTGTACACCAGCAGA
GTGGGGTTGCAAGGAGAGTATGTGCAGCTAAACGCTGTTG
ATTTCTCTGATTCTTCCGAACACATGCCTGTGGTGAGGAT
CTGTCTACCATGGCAAGCAGAGGGACTGAAGGGAAATGTT
GAGCGTTGCTGTATGATGACTCTGACAGTCCTGGATGAGG
CTCAGCGCCCCTTCTGGTGTGTGAGTTCACCTGTGAGGAT
GTCCAGTAATCCGAGAGTGGTGGACGTGGAGTACGAAGGT
GAGCAGTTCATCATCCTTTATGAGGACGCGGAGGGGAAGG
TCAAAATGACCTTTGTGTGGATGGAGGAGTTCCAGCACTT
CTTCTTGGTGCAGTTGTTTACTGTGTTCTCAGTAGCCAAA
GTGAAAAAGCACTTTTGGGGGTGAATGACTTTGATTGTGC
TTTGAGCTCGAAGATCATTTAGAATATTTTTATTTTCCTA
TTTTATTTATTTTTTGCTCTTTGTTGATGGAGATATCTGA
AATGTTTTGTTGTGGAGTTTCAAGGGCTTTAACGTTTCCA
AATGAAAAAAAAAAAACAGCAAATCTCAAAGCACTTAATT
TTTCATCAATTTAAAATTGGTAAATGTTGTTTACACACCT
TTGTCATGTTGTTTCTCATTGTCAAGAATGAGAATACGTA
GCACTGTTTACTATGCAAATAAACTTGCACTGTAGAACCA
AAATGTTCAA

zgc:161973 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:161973-201 1850
ncRNA zgc:161973-002 (1)    Ensembl 747
zgc:161973-003 (1)    Ensembl 317
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:161973-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031827 (1),  Ensembl_Trans:ENSDART00000043956 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC133820 (1) 1822 bp
GenBank:BC124186 (1) 1798 bp
GenBank:DT872108 (1) 850 bp
CITATIONS (2)