Transcript

atr-002

ID
ZDB-TSCRIPT-090929-13400
Name
atr-002
Previous Names
  • atr-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031766 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031766|OTTDARG00000024280|ZDB-GENE-070912-458 atr|no_translation atr-002 LG_none CR788262.4,CR377211.7 Danio rerio protein_coding KNOWN, 770 bp
GTTCAACTGCCTCATTAATAAGGTAGCGGGCCCATGCTGT
TTAGGAAATGACCAAATTATTTTCATGAGAAATTGGCCAG
TAAAAATGTGCCTTTGTCAGTCTTTGAGGAAAGATGCCGA
GTCTAGACGGAGGGATTTGCGCATTCGGACGTACGCTGTG
ATCCCTCTAAATGAAGAGTGCGGAATAATCGAGTGGGTGA
ACAAAACAGCAGGCTTACGCCACATCCTCACGAAACTGTA
TAAAGAGAAAGGGATCTATGTCAGTGGGACAGAACTGAAG
AAGCTCATTTTGCCAAAAACAGCACCTTTTCAGGAGAAGC
TGAAGCTGCACAAAGATGTGCTGTGTGCCAGACACCCTCC
AGTGTTTCATGAGTGGTTCCTGCGGACCTTTCCTGATCCC
ACCTCTTGGTACAACAGCAGGTCTGCGTACTGCCGCTCTA
CTGCCGTCATGTCGATGGTGGGTTATATCCTTGGACTCGG
AGATCGACATGGAGAAAACATTTTGTTTGATTCTTTTACC
GGCGAGTGTGTCCATGTGGATTTCAACTGCCTTTTCAACA
AGGGGGAGACGTTTGATGTTCCTGAGGTGGTTCCTTTCCG
GCTCACCCAGAACATGGTTCATGCAATGGGGCCCATGGGT
ACAGAGGGCCTGTTCAGACAGGCGTGTGAGGTCATACTAA
GACTCATGAGAGACCAGCGGGAGCCGCTCATGAGCGTTTT
AAAAACATTCCTGCACGATCCTTTAGTGGAGTGGAGTAAA
CCTGTGAAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations