Transcript

kdm4ab-201

ID
ZDB-TSCRIPT-090929-13367
Name
kdm4ab-201
Previous Names
  • kdm4ab-001
  • si:ch211-262l3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031727 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031727|OTTDARG00000024259|ZDB-GENE-030131-6279 kdm4ab|OTTDARP00000025790 kdm4ab-001 LG_none BX640408.8,CU459002.17 Danio rerio protein_coding KNOWN, 4339 bp
ATGCGCAGAGCTTGAGTGCTGATGGAGGTTTGTCAGAAGA
AGCATCTGCTGTTAGCCAAACATCTATACGAAGGTTAAGG
GAAGTTATTAGGGTTTTGTTTGACAAAGTCAGTGTTAAGG
ACTCGGTCAGCCAAGATGGCATCTGACATGCCAGTTTCCA
GGGGTATAATGACCTTTCACCCCACCGTTGAAGAGTTCAA
GAACTTCAGCCGCTACATTGCGTACATGGAGTCACAAGGT
GCACACAAAGCAGGCCTAGCCAAGATCGTCCCACCGAAAA
ACTGGAAGCCTCGAGGTTCTTATGATGACATTGATGACCT
GATCATACCTGCACCGATTCAGCAGGTTGTGACTGGGCAG
TCGGGGCTGTTCACTCAGTACAACATCCAGAAAAAAGCCA
TGACTGTGAAAGAGTTCCGCAAAACCGCCAACAGCGACAA
GTTTTGCAGTCCTCGATATGATGATTTTGAAGAACTCGAA
AGGAAATATTGGAAAAATGTAACCTTTAATCCTCCCATCT
ATGGAGCTGATGTGAATGGGACACTTTATGACCCGGATAT
CAAAGAATGGAACGTAGGGCACTTGAATACTATCCTAGAC
ACAGTGGAGCATGAAAGTGGAATCACTATCGAGGGAGTGA
ACACACCCTACCTCTACTTTGGCATGTGGAAAACCACTTT
TGCCTGGCACACAGAGGACATGGATCTCTACAGCATCAAT
TACTTACACTTCGGGGAACCAAAGTCTTGGTACACCGTGC
CTCCTGAACATGGAAAAAGACTGGAGCGGTTAGCTAAAGG
CTTTTTCCCTGGAAGTTCACAAAACTGTGAAGCCTTTCTC
AGACACAAGATGACTCTTATTTCACCTTCCATTTTAAAGA
AGTATGGCATTCCTTTTGAAAAGATCACTCAGGAAGCTGG
AGAATTTATGGTGACGTTTCCGTATGGCTATCATGCAGGC
TTTAACCATGGTTTCAACTGTGCTGAGTCTACAAATTTTG
CCACGAGGCGATGGATTGACTATGGAAAACAAGCCATACT
GTGTTCTTGCAGGAAAGACATGGTGAAAATCTCCATGGAT
GTGTTTGTGAAGAAATTTCAGCCTGAACGGTACGAGCTGT
GGTTGGAGGGGAAGGACAACGCACCCATTGATCACTCTAA
ACCCACGCCTGAAGCAGCTGAGTTTTTAGGTGGAGAGGCT
GGTGCTCAAGAACTCCGCATTGAGAACCAAAGTAATGAGG
GACAAAAAAAGAGCCTGGCCAAACAAAGGATAGGAACCAA
AAGACACAGGGTGTGTCTGGACTTTCCAGAGGAAGTTCTT
CCAAAGACTGAAACAAATGATGAGGCTGAATATGGCAAGA
AGGGCCGATTGACTCCATACACAGAACAGTGCAAGGAGTA
TACAGAGTTGAAGCATGAAGACCGCACACTTCCACTGATG
GGTTCAACCAGTTTAAAGATGCTGCCAGGATCCAGAAGTG
CTGAATTTTCGGAAAACGTTCGGGGTGCTGGTTTTAGTGA
CGCAGACCTGGATGCTAAAGCAACTAGCCATATTTCAGCC
TGTGCGCAGCCCTTCCCAAAGCATCACCTCTCTATCGCAT
CTGTCCCTACTGTCCCACACTGCTTGTCAGCTGTGCCACG
GGTATCCACCAAACCAGGGGTGGCAAGCCTTCTCTTTCAT
CGCACCCTCAGCCCGACAGATGCCCTGCAGGTCCACAGCT
ACGCAGCCAAAGCTGCACTCTGTAAACCACAAACACCCAG
TCCAGAGAAACCCAGAGAAGACCTACACATACCAGACATC
AGTCTAGACGTGAGGCCAAATACACCAACTCCACCCCCAG
ACACACCAGAGCACGAAATTGAAGGTGAGAAGGAGAATAA
CAGCATGAAGAGGAAACTGCAGCCGCTCAGCAAGTTGCCG
CGTTTGCATCCTCTGCTCCGAGAGAACTCCAGTGATGACG
AGATCCAGGAGCCAACAGCTGAGCCAGAGGAGACCGATCC
CTGGGCTAAAATCCTGGCTCCCATGTGGCAGAGCAGACAA
CGCAACTTTCAGATCGAGAAGGAGTTCAACTTCCGCATGG
GCCTGCATCCACCGTACTGTGCAGTGTGTTCCCTCTTTCA
CACCTACAATGAGAGTGATGTAATCAGCCTGGGCGGTTTT
GCAGCTGTAGGAGGAAACCCACAAAGGACCAAACCTCTGA
TTCCAGAGATGTGCTTCACCAGCAGCTCTGAAGGACATCT
GTCCACTCCTAACCTGGAGGCGGACGGCACTAGCCAACTC
ATCAGCTGCTCTGTGTGCAGTGTGCGCGTACATACAAGTT
GTTATGGTGTGTCTCAGGATGCTAAGTTAGACAGCTGGAG
ATGTTCCCGCTGTGAAGCTAACGCCATTACTCAGGACTGC
TGTTTATGCTCTCTGAGAGGAGGAGCACTGCAGAGAGCCA
ACAATGACAAGTGGGTTCATGTGTTGTGTGCTGTAGCAGT
GCTGGAGGCTCGCTTCGTCAACATTGCAGAGCGCAGACCG
GTTGATCTCAGCACTATCCCGTTTCAGAGATTTAAACTGA
AATGTCAATTCTGCCGAAAGTGGGTTAAGAAGACCACAGG
CTGCTGTGTGCAATGTTCGCACGGCCGCTGCTCCACTTCC
TTTCACGCCACATGTGCACAGGCAGCTGGAGTTCAGATGC
ATCCTGATGATTGGCCGTTTGTTGTCTACTTCACTTGCTG
GAGGCACAAGGGCGGCACCCACATAGAGCGCAATATGGCA
TCCATGCGGGAGTTGGAGAAAGGACAAAAAGTGATCTGCA
AGCACAAAAATGGCCGGTACTATCACTGTGAAGTGGTTGA
GCTGACTAAGGCCACCTTTTATGAGGTTATATTTGATGAT
GGCTCATTTAGTGACAACCTCTTCCCTGAGGATATAGTGA
ATAGAGACTGTACGCGGCATGGTCCACCATCAGAGGGCGA
AGTGGTTCAAGTACAATGGACAGATGGCCTCATCTATGGA
GCCAAATTTGTATCTGACCACATCATCCCCATGTACCAGG
TTGAATTTGAAGATGACTCTCAGCTTACTGTGAAGAGGGA
AGATGTGTTCAGTTTGGACGAGGAGCTGCCCAAACGTGTT
AAATCCCGACTGTCTGTGGCATCAGACATGCGCTTCAAAG
GAGTGTTTGTGGAGAAGGAAGTGAAGCAGGACTCAAAAAG
ACAGCGAGTGATCAACTCCCGTTACAGAGAAGACTACATT
GAACCGGCCATCTACAGAGCAATCTTGGAGTAACTCAATC
CACAAACAATATCTTTAAAACAAAAACCAATTCACCAATA
ACACGGCAAACAGAGAAACAGGCTGGAGCAGACACATCGT
CACATGATCGGACAACGGCAAATACAATTCTACCGCTGCG
CCTTTTGTTTTTAAAACCATCAAGATCAACTTTTTAGGCC
GAGTATGAATTCGGACAGCACAGATGAGAGTCTCAGAGAT
GAAATGCTAGGAATGTCTTGTGTAAGAGTGTTTGTTTGTT
CGCACAGCACACAAGCGGTTCGGGATCAGCGGGTGGCGGT
GGACGGCTCTCGGACTCCTACTATCTTTAGTCAGGTGGCA
GTAATGTTTTTTAATCACCTCCCTGCAGACCCACCGGCTG
ACCGAGCATCAACAAACCTTTAGATGGTCCGACCGATCTG
CGGTCAGCATGGATGATGCGTCACCCCGCTGACCTTTTTT
ATCGGTCTGAAAGTGCTTGGCAATATCAAAACCTCATGGA
TGTACCTAGTCTTTATTAGTACGAGCAGCTCTCATGTGTG
ATCTACTGTAAACATGAGACGTCGTAGAGAGATAGCTTTA
TACTCTCACGGTTAGGTGCATACAGCAGCTTTAGTTTTAT
TTAATTTATTCTTTTGTTGAAGTGTGAGGAACGGCCGTTT
CCTTGTTGAGCATCAGTTCTGTTTGTAAACCGATCTATTT
ATATGTTGAAGGCAGGTTTTTTCCTACTTTTTCTACTCTT
AGTTGGTTAAACTGGTGCACTTATCCACATGTTTGTTTCT
GTTTTCCTTCAGTTGTGAGTTTTTTAATCATGGTACTTAA
GGCAGGGAAGGCAACATCTCTAAGTGCCCTGTTAAGAGGG
CGCCTAAAGAAGTGCCTCGTTCAAATCATTATTTAAAATA
ATGTGTTTTTTTTTTTTTTTTGTGGAGATTGCTTTAGTTG
TTTAGCATTACAGACCCTTCAGTTGTCTTGTGTGATAGGC
ATTACACTCCTTTGTCTTGGATTATAGATCCATTGTTAAT
TTAAGGCTACAAAAAAAAACTTTATTTTTAAATTAAAAGC
AATGTCTCCTTTTCCCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations