Transcript

dis3l2-201

ID
ZDB-TSCRIPT-090929-13041
Name
dis3l2-201
Previous Names
  • dis3l2-001
  • ottdart00000030949
  • si:ch211-273k1.4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030949 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030949|OTTDARG00000023689|ZDB-GENE-070705-171 dis3l2|OTTDARP00000025177 CH211-273K1.4-001 LG_ BX001029.16 Danio rerio protein_coding NOVEL, 5108 bp
GCAATCGTGACGCTTTTTTTCTTTTTTTAAAGGATCCGGA
AGAGTTCGTAGGGGGTTGTTCAGAAGTGTTCAGTGAAATA
GACAAGAGTAACTGTAGACGAGATTATGGCATTTTCCCCT
AAAGCAAAGAGAACCCCCAAAAATAAAGATGGGAAAGGTG
CGCAAAATCTACCCAAACCCCAGAAGGACGCTTACTCCAG
ACTTCTGAATCAGCACCAGAATGGCAAGTTTCGTTCTTAC
TTGCAAGAGTTTGTAGAGCAGCAGTCAGAGGAGAACGCGA
CTACATCGGTTAGCAGGTCTGATGCCAACAGGAGAAAAAA
AGGCCATTCAGAGTCATCCTATTTCGGTGATAGCGTCTCC
TCTCCGCAGAGTAGGCCGATGTTGGCTGACACTTTCAACT
CTTTTCACGCGGACAAAACATTCCATCAGGTAACATGCGC
TGAAGACCCGGGCACGAATCCTGGCATGCTGGAAAAGTTA
CATAAGGGTTCTGCTCCCAAAAAGGCATCCGCTAAACTGA
AAAAGAGTGAAAAAGACATCAAAGCGAGCACGAGTCTGGT
GGGATCTGAGGAAGGCGACGCTCAACAGTTGAGCGGTTCA
TGCGGGGAGGAAAAAACGAGGAAAAAATCAAAGAAGAAAA
GCTCAAAAGGACATTTGGAGAAAAAGGACAAGGGCGCGTG
TGGTCTTGAAGTCGACGCTGCTGAGAAATCTGCAAATAAA
AATGTCAAAGCTTCTCAAGCATTGAAAGGCTCACGGCAAA
TTGACAAAAAAGATATAAATGCCAAAGATGGGCGAGCGTC
CGGGAAGCAGGTTTTTGAGCAGTACATGTCTGTGGAGGAT
GTGTCTGCAGGGCTCAAGAGAGGAGAACTCATTCAGGGAG
TGCTGAGGATAAACCCAAAGAAATACAAGGAAGCGTATAT
CCCATCTCCTGATGGGTCAGCCGATATATTTCTGGATGGG
ATTTCAGCTCGTAACAGAGCTCTCAATGGAGATGTTGTTG
TGGTGAAAGTTCTCCCACTTGAACAGTCGCAGGCAACGAA
GACTCCTGATGTCATAGTAGAGGCCCATTACAATGGAGAT
GATGAGATGGTCTCTAAAATGGAGAAAGTCAGTCTCAATG
ACAAAGCCCTTCTCACAACACAGTCTGTTGAACATGCAAC
GACATCCAACACTCCTGCATCAAGTTCAGAGAGAACTACG
CAAAAAAATGGGAAGGTTGTATTCATTGTTGAAAAAAAGC
ACAGCAGGGCAGTATCAGGCTTTCTCAAATTTCTTCCCAA
CAAGAGATTTGCCATGTTTTCTCCTGTGGATCACCGAGTC
CCGAGAGTTAATGTGCCTCTAGCGGACTGCCCTGCAGACT
TCACTTCCAGGCCTGGAGACTACGAAAACACACTGTTTAT
CTGCCGAATTACACAATGGCCAGCAGACAGCAACTTTGCT
GAAGGGCGGCTTGCAAAAACGTTAGGGCAAGCAGGTGAAA
TAGAGCCAGAAACAGAAGGCATCTTGACTGAATATGGTGT
TGATTTCTCGGAGTTTACAGAGGAGGTCTTGAATTGCCTT
CCTCAAGATCTACCTTGGAGCATCCCTGCTCATGAGCTGT
CTACAAGAAGAGATCTCAGAAAAGAGTGCATATTTACCAT
CGACCCAGCTACGGCCAGAGATTTGGATGATGCGCTGTCC
TGCAAACAGCTCTCAGATGGCAACTTTGAAGTTGGTGTTC
ATATAGCTGACGTGAGTTACTTCGTGAAGGAGGGAAACGC
CTTGGATGAACTCGCTGGACAGAGAGCCACAAGTGTCTAT
CTAGTCCAAAAGGTGATCCCCATGTTGCCCCGTCTTCTCT
GTGAGGAACTGTGCAGCTTGAATCCTCTGACAGATCGACT
GACTTTCTCCGTCATTTGGAAGCTTTCTCCAGAGGGAAAG
ATATTGAGTGAGTGGTTTGGGCGAACCGTCATCTGTTCCT
GCATTAAGTTGAGTTATGATCATGCTCAGAGTATGATTGA
TGCTCCTGACAAGCACTTTAGTCCTGAAGAACTGCCAGCC
TGTTCCCCAAACCACAGCATCATCGAGATACAAGAGGCCG
TCCTCAACCTGCACAACATCGCCAAACAGCTCCGAGCTCA
GCGCTTTGAGGGTGGCGCTCTCCGACTTGACCAGCTGAAG
CTGTCTTTCACCCTTGATAAGGAGTCCAGCATGCCTCAGG
GCTGTTACGTCTATCAGTATCGAGACAGCAATAAACTGGT
GGAGGAGTTCATGCTGCTGGCGAACATGGCGGTAGGGCAT
CAGATCTACCGCTCGTACCCAGAACTGGCACTTCTTCGGA
GACACCCGCCTCCTCAGACCAAGATGGTGGATGACATGCA
GGAGTTTTTTGACCAGATGGGCCTTGACATTGACTTCTCC
TCATCTGGAGCACTCCATAGAAGCCTGAATGAAAATCTTG
GTGATGACGAGTATACAGCTGCCAGGAAAGAAGTCATCAC
TCACATGTGCTCCAGGCCAATGCAGATGGCGGTGTATTTC
TGCGCAGGAGCTCTGAAAGATGAGAAGTTGTTCCGTCATT
ATGCTCTGAATGTGCCGCTCTACACTCACTTCACTTCACC
TATTCGGCGATACGCTGATGTCATCGTGCACCGTTTGCTG
GGCGCCTCTCTGAATTGTGGACCCCGTCTCAGCGTCTCAG
GAGAGGAAGTGCACCAGCAGGCGTCTCACTGTAATGACAG
GAAGACCGCCTCAAAGAGAGTCCAAGAGTTGAGCTCTGAA
CTTTTCTTTGCTGTTTTTGTGAAGGAGTGTGGTCCTCTGG
ATTCAGAAGCCATGGTCATGGGAGTTCTGGACCAGTCCTT
CGACGTGCTGGTGCTTCGATATGGAGTGCAGAAACGAATT
TACTGTAATTCATTAGAAGGTCTAAAGGAGGTCGAGTTTC
GTAAAGTGGGAAAGAAGCCAGAGATGACGCTTGTTTGGGA
AACGGATGACCCATCTAAGGACTCCATAAAACAGGAGATC
TCCATCTTCACCCTGTTGAACGTTCAGCTGAAGGCAGACG
GAGCTCCTATGAAATACAGCGCGACGCTCAAGAGACCCTT
AGCACCCATGTAAACCCCACCAACACCACTTTACTTCAAC
CAAACAGATTTGTCAGTAGTTCACACATCTTTTGCACGAA
CGTACCATGAACTCCGTTTTAATCCCTCTTCTTTGACTTT
TAAGATTTTGTTCTCAAGACTTTTCGAAGACGGAAAGAAG
TGTTTTTATTTTAAGCTATTTTGCTTTAGCCTCAGGAATT
GTGACGTTTTGTTCAGGGATTGTTTTATACATTTTCAGCG
TCTCTTTTGAATCTGAAATTCTCCCATATTAAGATGCTAC
TCTTATTTCATGCTTCGGGTTTTATTTCACACTTTCGCAA
ATGTGTCCTTTGTAGCTTACAGACATTTTTGTTTTGTTCT
GCCTTAACCTGCGGCCTTTGCATTAGAAACGATTGCTTCA
GAAATGACATTTCGTTAACTTCAGAAGTTATGTTAATGAT
TATTTTGTTTTCCCAATGGGAAGCATCGAGCCCTTAACAA
AGATACCATTTTTATTAAGTGGTTTTTGAACAGTGCATTA
TTATCTATGGCCGAGTCGTTGGTTTTGTCGCAAATAGTGG
ATGTTTTCTTCTTAAAAAGGAACTTTGGGTGAGTTTGTTT
TGTTTCTAGATGCTTTTAAATGATCCATTTTGTTTTAGAA
ATGCTTTTTGCATTGTAAAAATCGATTAGTTACTATACTT
AAAGTGAGTAAACCTGTTGCCTTCAAAGTGATAAATTGAT
TTAAAAAACAAGTGGGTAAGACTTTAGTTTAATGGTTACT
ATTGCACATTTTGTTGACTAAAAGTTGCGTTGCAACTACA
TGCCAATTACCACTCATTTGAGTATTAGTAGACTGTCTGC
TTAATATCTGCTGATGCTGCTCCTTTAACAGACAGTTAAC
TGACTATCAGTAACTTTGCAAGTACATGTCAACTTACACT
AACTCCAACCCCAACCTAACAGTCTATTTATAATCTATTG
AGAATTAGTTGGCATGTACTGTAGTGCAATGTTACTTAAA
TTCAACAAAATGCATTAAAGCGACCATCAAAACAAAGTGA
TACTAAAAATAGAGTTATTCCATTAAACTGTTAAGTTGAA
TGAACTTATTTTTTTATACATGTATGCACAGTTCGTTTAC
TTGATCATTTTTAAGCCATTTGTTTAACTCATTTAATAAG
AAATAAAGTCAACTAATCGCTATTTACAAGTATCTTTGCT
TTTTAAAATATCTGGCATATTGATTTACTTTACAGTCACT
CCGTTGTAGTGTTGTCACGATACTGGAATTCGATACCAAT
CAATTTGCCGTTGTGTTGACGTGCTCAACAAAAAAATGAC
TGTGATTGGGCGTCAAGGTCACCGTTGCTGTTAACTGAGT
GTAACCACAGATACAGGGACACTGGAGCGTTTTAAAGCCG
CGATTCATCAGCGGATCGCTCGTATGTCAGCTTATAGACA
AACCAGCTGATCGACATGACTTTAAAACGCTGCAGTGTCC
CTGTATCTGTGGTTACAGTCAGTAAACAGGGATGAGTTTG
GTGAACTGATGACCTTCACGGCCAATCACAATCATTTCTG
TTGAGCATGTGAACACAATGGTCAATCAGCGCTGTTTAAG
AAAGTGCTCAATTGTTAGCGGGAAATTTTAGCACTGATTG
GTATCGATTTCCAGTATCGTGACAACCCTACTCCAATTAC
CCTGAATACATAGGCTTTGAACACTTAAAATTCAAACTAC
TTATTTAAAATGAGTTGAACCAACACAATTATTAGGTATT
TTTTTGGAGGACAAACTTAATTATTTTATGTTCAATCCGC
TTAAATTTGTTAACTTAATCGATTTGTGTTGGGATGACAT
GGAATCGTGTGGACAGAATTTGTTTTACAGGGAAGCTTTT
GTAAATACAGACTTTTGGTTTGATCGATTGTGTTTTAAAA
TGTAATTTATATAATTTGATGCTTTCATTTTTGACCCACT
TCCATGTGTGTTTAAGTGATCTGCTAGGATATTGATAACA
GTTATAAACGATTGATCTACTGTAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations