ZFIN ID: ZDB-TSCRIPT-090929-12987
Transcript Name: rif1-203
Previous Name: rif1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030895 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030895|OTTDARG00000023663|ZDB-GENE-030131-3406 rif1|OTTDARP00000025151 DKEY-16P7.5-001 LG_ CR391905.6 Danio rerio protein_coding NOVEL, 7574 bp
AGCGTAGTCGAGAACATTTAGCAGCACTTTACGCTATAAA
CTCCTCCGATTCCTCTGATATAGTTTGAGTTTTGATGAAA
TCGCCTTCAGAGCCTGTCAGCGAGTCCTCAGTCGCGAGGT
TGTGAGGATGATGGCGGCAGTGCCTTTATCCAGTACCAGC
CTCCTTCCTCTTCTGGAGTGTTTGGAAGATGAATCAGCTG
GGCTTTCAGCGCAGACGGATGCCTACATCACCATTGCAAA
CCGACTTAATGGAGAAGAAGGACGCCAGTTTCTGCCTGTG
GTTGTTAAGCATTTTGCACGTCTTAGTAAAGTGCTTTTGG
TTCACATCTCCAGTGAGAATGAGGAGCTGTGTCAGGCTGC
ACTGCAGGCTTTGGGATTCTGTGTCTTCCACTCACACATA
GTTTCAGTCATACCAGCAAATATTTCAGAGAATATATTGT
CTACGCTCTGCAATGTTGTGGTAAAGTCCAAAGAGAAGTT
TACGTGCACTCGGGCATTGTGGGTCATTTCAAAACAGAAT
TTCCCTCCAGAGGTGGCATCCAAAATGGCCCCAGAGATTC
TCAAGAGCCTAGAAGCGATGCAGACCAGAGAGGTGCAGTC
CATCCTCATTGACCACGAGTCACTCAATGTCATCATAAGG
TTACTGGAGCAGGCCCCTGTTCCGATGGCTGTTGGTGCTG
TTTGCTGGGCTAAACTTGTTATTCCTCTGGTGGTTCATTC
GGCCAATAAAGTGCGTCTGCGAGCGGCAGCTGCCCTGGAG
CTCGGCATGCCTCTTCTTCTGGAGAAACAGCAGGAAGTGG
CAGCCATTGTTGAGCCAATGATGTCTTCTGTGCTCATCCC
TGAAATGCAGAAGCTCTTTGCGTCTAAGAACGAGACAAAC
ATGTTGAAACTCTGGCCTTTGTTTGTAAGACTTCTGGGCA
AGTTACTCCACAAAGGCGGTGCTTTCATTAACTCCTTGCT
GTATCTAGAGGAGCTGGGTTTCCGCAACTCTTCTCCTAAT
ATTAAGAAGATTGCTTTCATAGCTTGGAAGAGCCTCATTG
ACAATTTTGCCCTTAATCCAGATATCCTGTGCAGTAGCAA
GCGTCTGAAGCTCCTCATGCAGCCGCTCAGCTCCATCCAA
GTCAGGACTGAAGCTCTTCTGCTTACCAAGCTGGAGGTCT
GGTGGTATCTTGCTGTCAAGCTCGGACCCAACCTGTCTGC
TAACTTTGAACAGGTTGGCGTGCCTCTATTGCACAGCACA
CTTCCTTCTGATTCTCCACTTCAGAGCCCGACTACACCTG
CTCGAACCTCTAACCCAAGCAACGGCACACCTAACACCCC
TAAGTCAGGCATTCCCTCCTGCAGCACGCCGAGCACGACT
CCTCGCATGAATCTGAACAGCAGCATGCAGGCGCCTCAGT
CCTATCGTTCCATTCAGCTCCTGGGACTAGAGATGCTCCT
GCACTGGCTTGTGGGTCCAGAGGTCACAGTCACAGCTGCT
CGAGAAAACCTTCAGCTCAGCCTGGAGCCCCTGACGCACC
CGCTTTTTACCAGCCCTTCCACCTTCAGCAGACATGCTTC
TACCCTCATATCTGCCAGCAAAGAAGGCATCATTACTGTA
GGGAAGCATGCTCCAGAAGCACTTCTTAATCTTATTTGGA
GCAACCTGATCATTTCTGTCAGTGCAGCAATTGAAGCTGG
AAATAAAAAGGAGCGACAGGGTTCAGAGGTCCTCACACTT
TTCCTGCAGGCATTGCAGTCCATTTTGTCATCAGACGCTC
TGCCTCCTGAACGTGCACTGCTTCTGTTGGAAGCCACTGT
AAAGGGAATACCTCAGAAGGTGCTTGGTTCTGCAGCTTAT
CAAGTGGCAAACATGGACGTGTTAAACGGTACTCCTGCAC
TTTTCCTAATACTGCTGTTCTATAAAAGTAACCAGCTCTC
ATCATTTCTTGAAGACGAAAGATTTTTTTCAAGCTTGGAG
ACCCTTGTAAGCTGTGGGTTTTGTGGACCCACATCGCCCT
TGGCATTTGGAGAGGCGGTTTTAGGAGCAGTTAATGGGAG
TGTGGAGACTGTTAAAAACAAGAAGCAGCTCTGGAGAATG
TGGAGTATGGTTGTAAGTCCTCTGACGGACACAATTACTC
AGACCAATGAAGTCAACCAAGGCGATGCTCTGGAGCATAA
CTTCAGTGCCATTTACAGTGCGTTGATGTTCCCCGTCATC
CACCTGCTGCCTTATTCAGCCTTACCACAGACCACTCAGA
AGGCCATGATCAGCACATGGTCCAGGCTTTACAAGGCTTT
TGCCCGTTGCTCAGCTTTGGTTGCCACAGCAGAGGAGAAT
ACATGCTGTGAAGAGTTGTGTGTCAAGATCTCTGCCTCTC
TTGACCGTGAAGCTCTAAAAAGTCTGTCTATGCTAGATGC
AATAGCACACATCTTGCTCATCATCGTTGAGAGTATGGAC
TTTTCTCCATATACCCCTCAGTTCCAGCAGAAGATGAAAT
CTCCTCGTACACCCATGAGTTGGGTACGCAAGAGAAGCAG
AGCCCTCGGGAATCTCTCAACCTTCCACACTCTTCTGATA
CAGACTCTAGAGGCTTTTCTCACTGCAGACCATTCAGAAG
AATCTGCAGAGCCTTTAAATGGAATTGGCTCTGCCTTGGT
GTCAATCTTGACCTCTCTTTTCACTAATATTACCCTTCCC
TCATTCTTACAAGAGGTGCTCTCCAGCCTCACCAAACCAC
TTGCACGTCTTTATGAGCAGTTCTCCTGTTGTGATGACCC
ATCAAAGCTCAGTCCAGAACTAGGGCACAAGCTGGAGAAA
CTGGCCGCAGACTTGCTAGGCTGCCTTCAGACACATTTGA
CTCTCCATGATGATGAATTCCTCACTGTGTTGTCGCCCTT
GCTTTGTGTACTTTTTTTGCACAAGAGCAAACAGGTTTGC
TCTGTGGTCACTCAATTCTGGAATGCCACTTTTGGAAATG
CGCTCACCTTGAGTTACCCAGAACCTCTGAAGTGTGTTTT
AAATCAGGCTAAGCAGAAGACTCCACTGATTTTACCTGGT
TTTGAAGTTGTTGATGTACCAGATGATTACAGTGGAACAT
ATATGAGTGAGAGTTCTCAGCTGGAGCCTCAGATTAGCGG
GGTAAAAGTGACCTCTGTGGGAAAGAGGGACTCTCTTTTG
GCAAGAGCAGAAGAGCTAACAGGAAAAAGTTCTGTAACCA
CATCAAAACCAGTGTCTGTAAAGCTGGACTTTGGCTCCCC
CAAGCCCTTAAGACGAGAAGCTCTTGAGGAGGAAGCATCT
GAAGATTTTGTTTTTATTCCACCTGAGATGAAAGAGAGAG
TCCTGACTGAGCATCAGAAGGAAGTGAAAAGGACTAAACG
GGTTGACATTCCTGCCCTGTACAATAATCTTGATGCCTCC
ATGGACACCACAGTCTTTTCACAGTATACTCAGAGTCAGG
AGGAGTCAATGGACACATTGCCTAAAGGTGAGAAGGATCA
TCCTGTGGAAGCGGCTAGTGTTCAACTGAGGGAGGTTGCC
TCAAATGAAGTACCAACCACAGATGTTAAAGTCCAAAAAG
TCACCAGTTCTGATATAGAAACTCCAGATAAAGCTACGCC
GAATAAAGATCAAACTTTGGAGATGGATCAATCACCATCT
ACTGGTGTCTCAGTTGATGTGAGTGGGCTTGAGAAAAGCG
CATTGGAGGGGACAAGTCCTAATATTTCAAGTTCATCTGA
TGTGGTATCTGGCACACCTCCTAAACCTAACAGCAGGCGT
CAGTCATTTATAACCTTAGAAAAATATGCTGAAGGGAAAT
CGACAAGTCCTGCAAGTCCTGCATTTACAGGTACGCTCAC
CCGGAGATCAAGAAGACTGGAGGCTTCACAGGCATCAACA
TCAAATCAAAATGATTCTCAACCTCAGATTAAAAAAGTGG
ATTCTCAGGAATCTCAAAAGATGAGCAGCATTGACATGTC
CATTCAAAATGAGCATGCTAGCATGGAAGTAAAAGATGAG
AAGTCAGTGGGAGCTAATCCATGTGAAGGTACAGATGAGG
AAGATGTTGTTCCAGATACCCAAACCCAAGTATCTGGTGA
CACATTGGGTATTAAAAGCAGTCCTGTGTCTAAAGCCCAT
GCGGAGGCACAGGGGACTCCTGAAAAAAATTCACAGAGTC
CTAATGATTCTCTAGCTAGTCAAGAACCAAGAAGGTCTGG
CAGAAGGCGAAGTAAACCTGTTCGTCCAGGGCAAGATGCA
GAGGAAATAAAAAGTAAATCTCAAGAACAAGCCAGTCAAC
CTGCAGACTCTGCGATAATAAACTCACAAAAGCCCCTTCT
TGCTTCACCTAGTAGTACTTTGACTGGAAGAAGGAAAAAA
AAGGTTGAGACCAATAAAATGGAAGACCAGCTGAACAATG
AAGAAATGAAAGGAGATCTCAGCCAAAGCGATTCACAGAT
TTCCGCTGCTGACCCTCCACAGACAGTAGGTGTGCATGCC
AATAAAGACTTAAGCCAGACTGAGTTATCTCCGAAGAGTT
CTCCTGTAACCCAGTCAAATAGCCAAAGCAAAGAGAGACT
GCCAGCTCTCTGCGAGTCTGAGAGTATGTCGTTAGGTAGA
CAGGAGACAAAAACACAACTTGAAGAATCCACAGAAAAGG
AGACAAATAATGACTCTCAAAACGCTTCATCTGCAGCGAG
ACCGAAGCATATACAGTCTACCACGTCTGACTCCGAGTCG
GATAGCCAGCAAATTGTCCGTAAACGAAGATCGAGGAGAT
CTGAAACTAAGTTACTGGAGATATCTGGTGTGCCGATCAA
AGAAGACTTGAATCAGACAGACTCCCAAACTCCAACAGGA
GTGAAGGGAAGAGCTATGAGGAGGAGAACCGTAGAAGGTG
CAGAGTCTAGTAAAGATTCCACATCAGCGGTAAATACAGA
GGAGTTAAGTGCAGGCAAGGAGTCATCACAAGAGCTTGGT
AGATACAGAACTCGACGTTCTAGGGGTTTGTTGTCTCCTG
AGAGTATGGAGTCTGAAAACTCTGATAGCCGAGAAGATGG
GGCAAGGCCTAAAAAGAGGCTGCGAAAACCACCATCAACA
GAGGTGTTACCTGTTGCTTCAGAACCCAAAGTTATTGAGA
TGGTACCAGAAAAGGACGATGTTCAGTCAGAGGTTTTAAT
GGAGACGTCAAAGGATGAGGCAGATCCTGAAAATATCTCG
AATACTTCAGTCAGTGAAACCAAAGAACTTGAGCAAAAGA
ATAAAGAGGAAGTCCCTGCCCCTTGTGATGCACCACATGA
ACAGATTATCACGGAAAAAGCAGCATCAAACAACAAAATT
GACACTGACTTAACTGATACAGACGAAAAAGAAACCGTCA
AGGCAGAGGGTGAAGAAGCTAATGAATCTTCGCAAACTGG
ATCAGAAGATTTTAAAAAGACAGATGTTTTGCATAAATGC
CCACATACAAAGGGACGGGGCCGTGCACGTAGACGATCTA
AAAACTGCAACTGCTTTTCCAACAACCGTGATGTGTTTTC
ACAGGACAGTGACTTCCAAGAATCACAAGATCTAAAAAAT
GAACAGGTTCCACTTGCTGCCAACATCTTGAACTCTCAAC
CTGATCAGTCAAGCCCATCAACTGCATCAGAAGAAAACAA
AAGCTCAGCAATTGAAGAAGTCCCTGTTGCGGATGTTCCA
TCACTTTCAGCCTTATCAGCTGATCTCCCATCTGAGGTTT
CACCTTCTGAAAGTCCCATTACAAAACTTGGGGTAATTGT
TTCTCAGCTACCAGAAGTGGAGAAAGAAGCACAGCCTGGA
TCATCCAAACCAATGAAGGATTCGAGCAAGGAGCTTGTAG
AAGAAGTGAATCGATTAAGTTCTGGATCCACAGGTGGTCA
AAAGCACAAAGGAGAAAATAGATTAGAAAACACTTCAGTA
AGCCAAGAACCTGTCCAGAGTTCAACACCTCAAGACACGT
CTCCAAGTCAAGGTCGTCCAGTGGACGATGCACCAATATG
CCAGGAGCAGTTAGAGTCTTCTCATGTCCAGCAGGAAGAT
GCAGTTAACCCAGCAGTGATGGAAAGAGAAGACCTTGCTG
TGTCAGAGCAGAGACAAGAGAAGGCTGTGTTGTCTGAAGA
GTTAGATGGAAAAGGTTTGCTTGACAAGGAAACTACTCTT
GTTGAAAAGGAAGAAGAGATGCAGGTTAATAACCAGGATC
TTCCTGTGGATGTCCAAGAAGAGTTACCTGTAGTGTCCCA
GAGTAGCACATCTGAAGCCTGCTTGGATTCTCCACCCAAG
CCAAAACTGTTAAGCGCACTCAGTGGTGAACTAGAGCCTG
GCCAGAGTCCAACTAGAAGTCGGTCTCGAGTCTGGTCACC
ATCTGCTTCTCCGTCTACCAGTATTCTGAAGAAGGGTCAG
AAGAGAGCATGTGAAGAGGAGACTCCATCCCCCATTCCCA
AGTCACGTCGAGTGTCTTTTGCAACTCCAATTTACCAGCA
AGAACTGGCTGATGACATTGATCGTCGTAGTCCGGTTATT
CGCACAAGTTCACCTAGGTCAAAAGTCTTGAGTGGACAGT
CAAAGTATATCACTACACCAACAAAAGGTGGCTATACAAG
TCTGAGTCCACGTAACCTCCGTAGCCCTGGATCCAAAAGC
TCTAAAAAATGTCTGATTTCAGAGATGAGCCAGGAGCCAC
GTCCTATTCCTAAAGATTGTGTTTATCCAGCACTTGTTGG
CTGCTCTACTCCAGTAGAAGCTGTTCTGCCACAGATTTCC
TCCAACATGTGGCCGCGTGGCTTCGGCCAGCTTGTTCGAG
CCAGGAACATTAAGACAGTAGGAGATCTGAGTGCTCTTAC
CCCTAATGAAATCAAGTCTCTTCCTATTCGCTCACCTAAG
CTGTCCAATGTGAGGAAAGCACTTAAAACATATCATGAAC
AACAGAGAAAAGGACGTTCGGATGACCTGAAGAGTTTTGA
CGAAATGGAGAAAATGACGTCTGAACCTGAAGAGATGGAG
CTTCCTCAAAACCAAGATGAGGAGCAAACATCAGGACCAG
AGGCTCAAACAGCAGAATCAGAGACTCAAGAAGACAAAGC
CTCAGAAGTGGAAGTAAATTCAGAAGTGGTGACTGAAGAG
AACCAATCTCATGATTTGCTCTCAGATATTGTAGCTCTTG
GTGAACGCTTTACGCCTGAGGAACTCAGTCAGCATTCAGC
CAGTCAGTTGGGTCTGATGCATGAACATCTGAGTGGAATG
ATGAGGAGCATTGTGACCAATCTGCAGTCCCGCTTGCTCA
GTAATCTGGACGATAGCTTGCCATGAAGACAAGAGACTGT
TTTCCTGACAAGAATTACCTTTTAACTTGAAGATTAACTG
TGGACTGCTCATTCCTCAAGTTTTAGCTTGAATTTTAGGA
TAGGTTAATTTCTAATTATGGTCTCTGAGAATAGACTTGA
ATGGCCAAAAGCCATTTCCATTACTACGTAAGTGTCTGTA
TTTTATGGAGTGATTTTTAAGGTTGTAAAATTGTGCTGAG
ATGCCAAGGAAGCATTTTTTTGTTTTTTTAAATAAAGTTA
TAGTATTAATACAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rif1-203 Contained in:
OTHER rif1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030895 (1)
  • Ensembl_Trans:ENSDART00000143972 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN017100 (1) 942bp
    GenBank:EE313070 (1) 887bp
    GenBank:AL726113 (1) 667bp
    GenBank:CO353749 (1) 600bp
    GenBank:CO357902 (1) 600bp
    GenBank:BI864174 (1) 594bp
    GenBank:BQ073943 (1) 594bp
    GenBank:CT724879 (1) 571bp
    GenBank:CK708531 (1) 570bp
    GenBank:BI863987 (1) 563bp
    GenBank:BF156203 (1) 541bp
    GenBank:AL925830 (1) 539bp
    GenBank:AI794089 (1) 538bp
    GenBank:BQ074158 (1) 537bp
    GenBank:CD590582 (1) 500bp
    GenBank:CK682696 (1) 490bp
    GenBank:CO357983 (1) 480bp
    GenBank:AW777276 (1) 440bp
    GenBank:CD605784 (1) 322bp
    CITATIONS (2)