ZFIN ID: ZDB-TSCRIPT-090929-12969
Transcript Name: optn-202
Previous Name: optn-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030872 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030872|OTTDARG00000023603|ZDB-GENE-030131-8103 optn|OTTDARP00000025132 optn-002 LG_ CR407595.28 Danio rerio protein_coding KNOWN, 1614 bp
CTGCAGCTCACGCTCCAGGAGGCTCGTGGGAGAATCGCAG
AGTTAGAGAGCAAACTGGAACATGCTGACAGCAGCGCACA
GACATCTCTACCCTCTGCAGCTGAAACCAATGCTAGCACT
GAGGTGAAGAATCTGGAAGATCAGTTGTTGAAGCTCTGTA
ATGAGTTGAAGCAAGCTCAGATTAAACTGGACGAGGCTGA
GAGCATGAAAAGAAACCTGCAGGACAGATGTAAAGATTTG
GAGCAGGATTTGGGCACTTTAAAGACTCAGCTCGGAGACA
AACAGAAGGTCCAGGCTGAGAACGACTGTCTGAAGGTTCA
GATGGAAAGCCTCCAAGCGGCGATCAAACTGGAACAGAAG
AAAACCCAAGATGAGAAGAACAATCTAAACCAGCTGAAAG
ATGCGTACACCAAGCTGTTTGAAGACTACAGTGAGCTCCA
GGAGGAAAAGAAGAAGAGAGAGGACGATTATGATGAACTC
CAAACCAGGTTTGCAACTGCTGAAAAGGCACTTGCAGATA
AACAGCAGAAAATCGATGAGATGAAGATGGAACTATTCCA
GAAGGAAAAGGATCTGGAAACCATTTCTGTTTTCCAGGCA
CAGGCAGAAATCTATTCCTCAGATTTCTACGCAGAAAGAG
CAGCTCGGGAGAAGATTCACGAGGAGAAAGAGCGTTTGGC
CACTCAGCTGGAGTATGTGAAAAAGCAGAACAGCCAGCTT
CAAGAGGAGATGGAGTCACTTGGGAGGCATTCAATGAGCG
AGATGCAAAGAAGGCATGTGCCACGAGGAGCCAATCCTCA
AGGGCCCACAGCTCCAAACAACCTGCCTGGAGGTAGAGGT
GAATGGCAGCAGCAGAACATTCCAGATCACGCTTGTCCTA
AATGTGGGGAAGTCCTACCTGACCTGGACTCCCTGCAGAT
CCACATCATGGATTGCATCATCTGAGCCTGTTGCCTAGTA
ACCTTACCAGATCCCCTCATATGTGAATGAGTGGTTTGAT
AGCTTTACCTTCTAGCACCCTGCAAATATACTGCTTCAAT
AACACCGGTCTACGAACCGTGCATCCTAATAATACTGTTA
TTTATCAGTCTGGAGGGTTTCAGATTAATACTATAGCTGC
AATCGGTCGAGGATGAGAATGAGCACTTAATGTGTAGCTT
TGACTGGTTGGATATACTCTAGCTGCATCCTGTATAATGA
AAATGTGACATTAAGCTGATTCAAGACACTTGACCAATGT
CAAATACTATGAGTATGAATATATAATGTTGCAGGTGGGC
AATCAGTGTGACGTAATATCTGTTGTGGGTGAATTACATT
ATTGTTTGCGAACATATTTTTAAGATTAGCTCTAATATTT
TTGAGTGAAGCAAGAGTTGTAGCTAAATTTATAATATATT
TTCAATGCCCTGCGATAAACAGTGAGCAACAGATTGTTTG
TTGGGACTGTAAAAATGTCAACGCACTTTATTTTGTTTAT
ACGTACATACAAATAATTAAAATAAGTTTATAAAGCTCCA
GCCTGTATTATCTATCACATATGGGTTCTCTCAGTAAGGT
TCTTTCGAGTTGATTTCATAACTTTGGTGCGTAATAAAAA
ACAAATATGTGTAA

optn TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA optn-003 (1) 2212
mRNA optn-201 (1) 2455
optn-202 1614
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
optn-202 Contained in:
OTHER optn-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030872 (1)
  • Ensembl_Trans:ENSDART00000133616 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT721305 (1) 813bp
    CITATIONS (2)