Transcript

nr3c2-202

ID
ZDB-TSCRIPT-090929-12951
Name
nr3c2-202
Previous Names
  • nr3c2-001
  • nr3c2-002
  • nr3c2.001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030852 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030852|OTTDARG00000023640|ZDB-GENE-060531-23 nr3c2|OTTDARP00000025116 nr3c2-002 LG_none BX511149.9,FP245442.5 Danio rerio protein_coding KNOWN, 1444 bp
TGCGTCGCTGAGGCACACGTCTTCGACAGCCAAAGTGTGT
CTGGTGTGTGGAGACGAGGCGTCAGGATGCCACTACGGGG
TTGTTACATGTGGAAGTTGCAAAGTTTTCTTCAAAAGAGC
GGTAGAAGGTCAGCACAACTACCTTTGTGCTGGGAGGAAT
GACTGCATCATTGACAAGATTCGGCGGAAAAACTGTCCGG
CCTGCAGAGTACGCAAGTGTCTACAAGCTGGGATGAATCT
TGGGGCACGGAAGTCGAAGAAGTTGGGGAAAATAAAGAGC
ATTAGTGAAGATTCTTCCCTGCAGAGCTCAAAGGATGGCC
CGTTTTTGACATCCGAAAAGGAGTTGAGTTCCTCCACCGC
TCTCGTACCACACACCCCGACGGTCGCCCCATATCTGACG
CCGTCCGTCTGCAGCGTTCTGGAGCTCATAGAGCCAGAAG
TGGTGTTCGCTGGCTATGATAACACACAACCTGACACAAC
AGACCACCTGCTTACCAGCCTCAACCAGCTCGCCGGAAAA
CAGATGATCCGAGTGGTCAAGTGGGCCAAAGTACTTCCAG
GTTTCCGCAGTCTACCCATTGAGGACCAAATCACGCTGAT
CCAGTATTCCTGGATGTGTCTCTCCTCCTTCTCCCTCAGC
TGGAGATCCTACAAACACACCAACGCCCAAATGCTCTACT
TCGCCCCGGATCTAGTCTTCAACGAGGAGCGAATGCAGCA
GTCTGCCATGTATGATCTGTGTGTGGGGATGCGGCAGGTG
AGCCAGGAGTTTGTTCGTCTTCAGCTCACATATGAGGAAT
ATCTGGCCATGAAGGTTCTGCTGCTGCTCAGCACAGTGCC
CAAAGATGGTCTGAAGAACCAAGGGGCATTTGAGGAGATG
CGGGTGAATTATATTAAGGAGCTCCGCCGCTCTGTTGGGA
AAGCCACTAACAATTCTGGCCAAACATGGCAGCGCTTCTT
CCAGCTGACAAAACTTCTGGACGCCACGCATGATCTTGTT
CGGAGCCTGTTGGACTTTTGTTTCTACACTTTCCGCGAAT
CCCAGGCTCTGAAGGTTGAGTTTCCCGAGATGCTGGTGGA
AATTATCAGCGACCAGATACCAAAGGTGGAGTCGGGTCAA
ACACACACTCTCTACTTTCATAAGAAATGACTGAAAACTC
ACGAAAGTAGGGGAAAACGAAGGATCAAATGAGAGGAAAA
GCAGAGGACACACAGCCCTCGGAGAGCGAACAAGAGCAAG
CCCGCTATGCACAAAGCAAGGCGTAATATGAGGCTTGGTT
TAAAGCCATATAAGGCTTGTGTAGTGAGGGAAGGCAAAGA
GAGATCTCTGTACCCGGCCAACGGAGAAGAACTCGAATTT
CATGTGACAGTGCGTCCCTTACCCCCAAAGACAATGCTGA
CAATGTTCTATATGGATATGAAGCCATATTCTTTGGTAAA
GCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations