Transcript

si:ch211-74m13.3-202

ID
ZDB-TSCRIPT-090929-12914
Name
si:ch211-74m13.3-202
Previous Names
  • si:ch211-74m13.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030808 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030808|OTTDARG00000023611|ZDB-GENE-060503-219 si:ch211-74m13.3|OTTDARP00000025080 CH211-74M13.3-001 LG_ CR381570.12 Danio rerio protein_coding NOVEL, 1673 bp
GACGGTGGGTCATGTGAATGTAAAACTGGAAGTGAAATAC
CGTGAAATAAGAAGGAGCTACGGAGTTTTAGTTTAGTCAG
TTGCTGCTCCCCTAAGAGTACGGGACATTCCAGTAATCTT
CATTACAGCTCGTCTACACAAGGGAAGGGGCAGTTCCGCT
GATTAAACCGCTGCTCACTCTCACTTTTATTCTCTCAGTG
GTCGAAGTGTAACCAGATCTACAACAGTGACAGGACAATA
CTAAAGCCCAGGACTCGAGCTGAACCTAGTTTGAAAATGC
AGAAAGGGTCGTTCTTTCTCGGCAAATCTTCACGGATGTC
CCATATAGGACTACTCGGAATTTGTTTTCTCTCACTAGTT
GCAGGTGCACTAGAATGTCCTCTTCAAATCAGCCCACAGA
GTGTTGTCGTGAGGTACGGTGATTCTGTATCAGTAAACTG
CAGCACTTCAGTCACACATGATGGGATGGGATGGGAATCC
ACTAAGGGAGGAGTGCCCCTGTCCAAAGCCAGTCTGATCA
CATGGAGAGTGTCACAGCTGACAGACTGGGAGATAGAGCC
ACCATTCTGCTACATAAACTATGGCCAACAACAACAATGT
GAAGTAGCTCTCCCAGTCACTATTTACAAGACTCCAGACA
GTGTTTCCATCAGCACTGCGAATCAAGCAATGACAGAGGG
AAACCAGTATGAGCTCCAGTGTGACATTCATAATGTGGCT
CCTGCTCAGAATCTCACTGTCAACTGGTACAAAGGAGAAA
CTCTGGTGAATCAAACCAACTTTACTGACAACACCAAGAG
TCCAGTCAATAAAATAATTAGACTCCCGATCCATCCAGAC
AGAGCTGATGATGGAGCTCAGTACAGATGTGAAGCAGAGC
TGAACCTGGGAGAAGAAGGACCTCAACCTCATCCTAAAAA
CACATCTGAACCTCTCAGCATTACTGTACATTTTAAACCA
ACCATCCACAAACTGCCCTCCACAGTGTCTGTGGTACGAG
GCTATTCAAAGGTGGTAGTTTGTAAATCGGAAGGACATCC
AAAACCAACAATCAGCTGGAGTGACGGCACAAACACAGTT
AATGGTGAAAACTTTACTATAACAGAGTCCACAGCTGAGA
ATCTGACCTGCACTGCAACCAATGCCGTCGGCAGCTCCAG
CAGATCAGTGACAGTGGTCATTCAAGAGAATATAACGCCT
ATAATAATCGGCATTGTTTGTGGCATATTGCTGGTCATCT
CAGTCATCTTCATCTACATCTACATCACCTGCTACAAAAA
AAACAAGATGGGCCATTATAATTTCAAGAAGCCCAAAGCA
TCTAAAGGACTCTTAGCGCAGCCAGCACAGACCCCATGAA
GGAACTCTGTCAGAGCAATGTGATTATGATTCGCTGAGTT
TGATTCATCTGCTGAACCTCACAGTCAGATCAGTCAGAAT
GAAATGTGAAGTGTTGTTGTGTGGACCAGTCTCAAATGTA
TTAGCAGCAGTGTTACACTTTTTCAGCATTTCTGCATAGA
TTACTACACTGTAAAACCCAACAGTCAACTTTATAAAAGG
AAATGAGTGTCCTTAACTCAAAATGTACTGAAAGTTAATT
CTACTCATTTGAAAAGTGTTTTGAACTCAGTGTTGAAGAT
AATGAGTTTATTAAACACCTCATTACTCCAACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations