header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12738
Transcript Name: dennd1b-201
Previous Names: dennd1b-001, ottdart00000030549, si:ch211-195i21.1-001, si:ch211-195i21.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030549 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030549|OTTDARG00000023453|ZDB-GENE-060503-16 dennd1b|OTTDARP00000024885 CH73-189A7.2-001 LG_none CR974425.13,CR388178.5 Danio rerio protein_coding KNOWN, 2317 bp
GGTGTCGAGTCTGAAGAGTAAGCTGAAGAAGCAGTCCACG
GCGACCGGCGCTGGTGTGGCCCGGGCCTTTCTGCACGCTC
AGGCCGCGCTCTTCGGATCCTACCGGGACGCCCTCCGATA
TAAACCCGGAGAGCCAATCACCTTCTGCGAGAAGAGCTTC
GTGGCACACCGTTCCAGCGCCATGAGAGGCTTCCTTGAGA
TGGCAGTGAACCTGCAACTCTTCAAGCAGTTCATTGAAGG
CAGACTGGCCAAATTAAATGCAGGAAGGGGCTTTACAGAC
GTCTATGAAGAGGAGATCACAGAGGGCGGCTTTTGCAAGA
GTAATTCGAAGTCTTATCAACAGTGGATTCACACCAAGAT
GCGGGAGAGGGCGAAACCAGTCGTGAAGAACTTTCAGATG
GCCAAAGATCACGCGAAGCGGAAAATACGCGACATGAAGG
ACAAGATTACACAAAAGGACACTGAAGAGGAGGAAAGCCC
ATACTGTGAAGGTTCTCCCACCAGCACTAAAAGCCTCTCG
CCCAGGAGACTTCAGAGGATAGCGTATCAAAACCTGAAGT
CATCTCCACACACGCTCTATCCTGACAGTTATAACAATGA
CGACAATGCTAGCAGAATCTCATCTGAGGACAGCGGGGAG
GTGCCGTCCTACAATGAGGACAGTGATGAGTCTGATTTAG
AGCTTCGGTCTGAAGTCAGTCAGTCAGGACAGATGAACCT
GCTGGAGGAGATTCTGGACTCGCTCAGTACATCCCACATC
GAGCAGGGCCGACTGTCCGCTGCCAAGAGCCTTGACTTCT
TCAGGTCATTCGAAGACCTCGACTACAATCCCAAGAAAAG
CTTCAAGTCTCCTCTGTGCAGTAGTCCTACTGCAACCGGA
TGTGAAGTAGGAAATGGAGAGCCAGCCGGCTGGAAAACAG
GTCAAGATGACAGCGCTGTCCACGGTAAACATCTCCCGCC
TTCACCTCGACGCCAAACTAGCTCCTGCTCCCTTCCAGTC
CATCCTCCCCCTCCCACCGAAGACATCCCGATGAGGAACT
CTCTCCCAGAGACTCCCACAATACAGATCCTGTTTCCCGA
CATGGAAAAGGCAACCAATTCAGCTGATGGCCTACTGAGC
CCCGAAAAAAAGCACCCAGCAGCTCGAAGCCTCTCCAGAC
AGAAGGTCCTTTCCAGAAAAACCCAGAGGCCCCATCAGGA
GCACAAAACAGCAAGCGGACAGCTTTCAGTGCATGTACCC
TGGGAGAGGGAAAAGCAGCTCCTGGGCACAGGTATAGAAG
GAGACAGTAGTGAGACTCAGGAGAAAGGCTTGTTAGAGGA
GATCGAGTCCATGTGTCGCATTAGCATGGCCTTTGATAGC
AACCAGGAGTTCATTCAGAACAACAGCAGTCGGGACAAAT
CCTGAGACAGCAGCACAACACTTGTTCATCATTGTCTGTT
TTGTCTTCTGACGTCACACCAGCACTCTTCCTATGTGAAG
GATCTGCAGGGGTGTTTAGTGGTTTATATGAATGATCGGT
CCTCTTATTTCTTAACCAAAGGGCAAAGGTTTTGGATCAG
TATTATTTTTTTTTACATCTGCTCACCAAGGCAGCATTTA
TTTGATCAAAACTTGAGTGAAAAATGTGAAGAGTTATTAC
TTTTTAAAATAAGCGTTTATTATTATTTTTGTAGATTTCA
AATAGAATTTTATAGATCACACAATCTTTTAGAAATCTTT
CTAATATGATGATGATCGCCACACATGCAAACAATGGCTG
TGTCTCATTTCAGAGGCTGCATCCTCCGAAGGATGCATTC
GAAGGGCGCTGCGTCATTACAGCACGACGAAGGTTGAATC
ATTTAAACAAAAATCGATGGCTCCTTTAAATGCAGCCTCA
AAATGCGTCCTTCGTTTCCCAGGTAATGAAGGACACAACC
AGTGGATCTTTTGTGGCCTTGAACGTTCCAAGATTCTTTG
CGCGCTGATAACTGCAGGACATTTTTAACAGAAAGCTCCA
GATTAAATGTATTAATTAGGTTTACCTTACTTGAATATCT
AAACAAATGTTAAAAAACAAAACACCTATGTCTTACTAAG
AGATCTGTCCTCTGTAGACTAGATCATCTCATTTCAAAAT
GTTCGGTATGGCTTGTGTGGACTTTGGAATGTGGCAGCCT
TTGAAATGAGACAGGTATTATTATTATTATTATTATTATT
AAGTTAAAAATATTTGGACTGCCATATGTGATCACAATTA
AAATATATTTAAAAAAAAATCTTTTTTAATTCATTAAGGA
CACTTTACATTGTAAAAAAATAAAATATATAACTTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dennd1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030549 (1),  Ensembl_Trans:ENSDART00000160457 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EV604307 (1) 276 bp
CITATIONS (2)