Transcript

crb1-202

ID
ZDB-TSCRIPT-090929-12736
Name
crb1-202
Previous Names
  • crb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030547 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030547|OTTDARG00000023452|ZDB-GENE-050208-382 crb1|OTTDARP00000024883 crb1-001 LG_ CR388178.5 Danio rerio protein_coding KNOWN, 4427 bp
ACACACACACACACTGGAGGAGTACACACACCGTCATCAT
GTCAGCTTGCCAACTATCACAATGACATCTAACTATGGAT
ATGGATCTAGCGGTTTGGGGTTCAGTGTGGCTCAGATTGG
TGGCTTGTGTCTTGTTTGTTCTGCTGCAATGGACAGAAAG
TGTAACACTACTCAAGACCTCAACACTCTGCCTGGACAAC
CCTTGCCAACACCAGTCAGAGTGCAGGGAAGCCCTGTCTG
ATTTCCTGTGCCAGTGTCAGACGACTGTGCCAGTCTTTCC
CAGCACGCGTTGTGATTCTTCCAGTACGTTCTGCCAACTG
TCCATCTGCCAGGGCAATGTGACATGTCAACCCACCGGCG
CCCACCCAGGGGAACTAGTTTGCCAGTGTGACTCCGGCTT
GCTGGGGCAGGACTGTCTTTCCAGTGCCCAGCTCTGCGCT
CAGGGGCATTGTGGGGACAGTGCCCACTGTCTGGCAGTGC
GAGACCAGAGCCCAGGGTACGCATGCATCTGTCAGGAGGG
TTACACTGGAAGATCTTGCGAAAAAGAGGTGGACCACTGC
TCTCCTAACCCCTGCAGAAACCGCGCCATCTGCCGCAGCA
GAAGGAATGGGCCCACTTGCTTCTGCGTGCCAGGATTCCA
GGGCCAGCTCTGCGAGATTGAGGTGAATGAATGTGTGTCG
AGGCCCTGTAGAAACGGAGCCACCTGTGTGGACAAGATCG
GGCACTACATCTGTCTCTGCAGGCCTGGATACATGGGTAG
CAGCTGTGAGCTGGAGATTGATGAGTGTCAGTCACAGCCC
TGTCTCCACGGCGCCAGTTGCCATGACCACATCAATGGCT
TCACGTGCACATGCCTGGCGGGTTTCCAGGGCGAGAGCTG
TGAAATCAACATCGACGAGTGCCGTGACCAGCCATGCCAA
AACGGGGCTCTGTGTGTGGATGAAATCAATAGCTACCGCT
GTGACTGCTCACAGACTGCTAACTTCACTGGTGTTGACTG
TGAGATCCCGCCTCCGCCCTGCTGGTCTCAACCCTGCCTC
AACAGCGCCCTCTGTGAGAATCAACAGGAGAACTACACCT
GCAACTGCTGGCCAGGGTTTGAAGGGCGTAACTGTGAGGT
AGACGTCAGTGAATGTGAAAGCAATCCCTGTGTGAATGAA
GGCATTTGCATGGAGCTTTCTTGGAAAACACTTTACGGTA
CTGAGCCCCTGTTTACAGCTAGATACAATCCCAGACTTGC
TTCCGGGTTCATCTGCAAGTGTCCGCCAGGATTCTCAGGT
GCCTTGTGCGAGCAAAACACAACTGCCTGTACCACCAGCC
CATGTCATAATGGAGCCACATGTGAAGACTTCCTAGGCAG
CTACAAGTGCATCTGCCCTTCTGAAAGCCAAGATGGAGTC
CTCTACGGTGGTCGAAACTGTAGCGAGCCTCTTACAGGTT
GCGAAGGTCACGAGTGCCAGAACGGAGCGTCCTGCATCCC
ATTCCTCAGCGAAGGTGTACATGGATACAGTTGCATCTGT
CAGCCTGGCTACACCGGCTCTTACTGCCAAACGCTCACTG
TGTTCTCCTTTGAGACAAGCAGAGCATTCTTGCACCTGCA
GACCCCGCTGCTGGGTGCAGAAACATATTTCAATATCACG
CTAAGCTTTCGTACAGTCCTGGAGAACACAGTGCTCTTCC
AAAGGGGCAGCGGAGGGGTCACACTCAGCCTGGAGATACA
GGAGACACACCTGATTCTTGATCTTAAGACTGACCCTCAG
CCAAACGCAACCAGCTGGACTCTGATGTTGCCTCAGGTTG
TATCTGATGGTGAATGGCACACAGTAGAAGCCGTACTTGG
AGAGGGTACCCTGCTGCTGCAGCTGCTGGAGCCATGCCAG
GGTGGACAAAACTGTGGTACAACAGCCCAAGTAAAGATCG
GCGCCCTTGAGCTGGAGTCAGCCCTACTAAGCACCTTTGT
TGGAGGATTGGATGAGGGAGGGAGCTCCAGATCATTCATC
GGCTGCATGAGGGACTTGCTCGTGGACTCGCAGCTGATGA
TACCGGAGGACTGGTTGAGCAGCTCAGCTGTAAATGTTGT
GCAGGGCTGTAGCCATCATGACCGATGCCTTTCTGGTCCA
TGCGAGAACCATGGAGAATGTGTTAACCTTTGGCAAGGTT
ACCAGTGCAAATGTCTGCGCCCATATGTGGGTCAAAACTG
TGATGAGGAGTATATTACCGCCAGATTTGCCCAGCAAGAC
TCGACAAGCTATGCTGTCTTCACCATCAATGACGAACCTG
ACTCGGAAACACTTCATCTGTCCATGTTCTTGCGTACTCG
AAAAGACTCTGGTCTTTTGGTGCTGCTGGCCAACAGCACC
TCTGACTACTTGCAGATGTGGCTGGAAAAGGGAAAACTGA
CAGTTCAAGTCAACAACTTGAAGACTGTGACTGGTGAAAG
GGTGCTTAATGATGGTGAGAGACATTTTGTCAGTGTCACC
ATCGAGGATGGCATGATGACTCTGCAGGACTCGGATCATG
AATTCGAAGCAACATATGTTCAACCTGTTTCCATTCAGTT
TGGGGATACGATCAATGTCGGTGGCCTGTTTGATGTACAA
GCCTTAACTGCGTTTGGTGGACATTTTAAAGGTTGTCTAC
AAGACTTGCAGCTTAATGAGAAGAAGCTTGAGTTTTTCCC
AATTGATACTTCTGCGATGTCGTACAAACCCGATCGCGTT
GTGAAAGTTACTGCAGGCTGCACCAGTGATGACACTTGCT
CAAAAAATCCTTGCCAAAATGGTGGCATCTGCTTTTCTTC
ATGGGATGATTTTACTTGCAACTGCCCTCCTAACACATCA
GGACAACACTGTGAGGAGGTGAGCTGGTGTGACCTCAACC
CGTGCCCACCACAAGCAATATGCCGGGCCCTAAACCAGGG
CTATGAATGCATTTCAAACGTGACTTTCCAGGAGAACACC
ACACTTGTATACCAAGGCAATGGGCTGATATCCCGCCATC
TGACCAGTATTGTCTTTAATATCCGTACACGTAAGCGCAA
TGCCATAGTGTTGCATGCAGAGAGTGGATCAGAGTTTGTA
ACTGTATCTCTTCAAGATGGATTTCTGGTTCTTGAGCTTC
TAAGTGGACCTACTACTTCATCCTCATTGTCACCAGTAAC
CCTGCACAGCCCAAGGGTAGTCGCTGATGGGGAATGGCAT
GTTATAGAGCTGTTAATGGCCACTCCAGGGTCTAACAGCT
CCCACTGGATTATGGTCCCCCTAGATGAAAAAGATGAGCC
TACTAAATCAGACTCTATGACCGGAAATCTAGACTTCCTC
AGAGAGAGCGTGTACATCATGCTAGGAGGACTAGGCCCTG
ATTCTGGCTCCAATCTCATTGGTTGCTTGAGTAATGTTGA
GATTGGTGGAATCGTGCTTCCGTATTATGGACAGACTGAG
GTGAGATTTCCACGCACACAGGAAGAAATGTTCAATAAGA
TATCCGAGGAGCCTGTTCAAACCGGCTGTTTCGGGGAGGT
GGTGTGTGAGCCCAATCCCTGCCTGCATGGAGGCATCTGT
GACGATCACTTCAACCTTTTTCACTGCTTCTGTCTTCCTG
GCTGGGGCGGTGATCACTGTGAGCTGAATACAAACACCTG
CGCCTCCAACCCCTGTCGACATGGATATTGTAGTGTGCAG
GACCTCACATACAACTGCACATGTGAGGACGGATACACTG
GCACCAACTGTGAGATGAAGGTGGATGCTTGTGCTGGGCA
CAGGTGTGCTAATGGAGCGACCTGCTTGCGTGGCTTCAAC
ATGTATTCCTGCCTCTGTACCGACAAGTTTACTGGGCCAC
TTTGCAACATTCAGATTGAAGAGGTTCCGTGGTACGTAGT
TGTCAGGAACATACCGCCAAAGCTCCCGGTGTCCATCTGT
GGCGATGAACAGCAGAACTACACATGTTTCAATGGGGGGA
ACTGTTCTGACACCAACATGCCGTGCGACTGCCACCCTGG
GTTTTCGGGTCACTGGTGTGAACTAGAACTTGATGAATGT
AGATCCAATCCTTGCAAGAATGGCGGCTACTGCCAGAACA
TGGTCAACAGGTTCCAATGCGTCTGTGAAATGACTTTTGC
CGGCGAGACCTGCGAAGTGGACCTGAACGCAGAGAGTGTG
ACGTCTCAGCTGTTGCTCTCCATCAGCCTGGTGTGTGTGG
TTCTGCTCTTGGTTGTTTTTGGTGTGACCACAGCTCTGGT
CATTGCACTGAACCGAAGGGCCACACGGGGCACTTACAGC
CCCAGTCGGCAGGAGAAGGAAGGCTCAAGGGTGGAAATGT
GGAACATTGTACAACCTCCACCAATGGAGAGACTCATCTG
ATGCTTTTTACAAGACGGCGGAGAAAAGAAAGTGCTTAAT
TATGTGGCAGCTATAAGAGTTGGACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations