header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12648
Transcript Name: map2k1-201
Previous Name: map2k1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030444 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030444|OTTDARG00000023382|ZDB-GENE-040426-2759 map2k1|OTTDARP00000024805 map2k1-001 LG_ CT863714.10 Danio rerio protein_coding KNOWN, 2093 bp
AATCTCAGCACCCATCCTCTGCTGTCGCACACCCATAGAA
ATACTCTAAATAAGCTATTTTTCGAAACAACCACTATCGT
ACCCGCAAGAAGACCATGCGAGACTGTCGTTAGCTGCATT
CTGTGTTTATTTATTTATTTATTGTAAAGCAAACAGCCAT
TGGTAGGGTGTGATAGGCTATTCATAGCTTATGCATCACT
GCTCTGTCGGCGGGTGAGTTGGTGTAGTCTGCGGATCAGA
TTGCTTCTGTTTGAGTCTTTTTTTTCGTCTGCTGCCGAGA
AGCCAGCTATTAGGATTCATCATGCAGAAAAGGAGGAAGC
CAGAGCCGATCCAACTGAACCCAATTCCAGATGGGAACGC
TATCAACGGCACCGGGGCCACAGAAACAAATCTGGAAGCT
CTGCAGAAGAAGCTGGAGGAACTGGAGCTGGACGAGCAGC
AGAAAAAACGCCTGGAAGCTTTCCTCACCCAAAAGCAGAA
GGTCGGAGAGTTAAAAGACGATGACTTCGAGAAGATCAGC
GAGTTGGGAGCAGGCAATGGAGGAGTTGTGTTTAAAGTCT
TACACAGGCCGTCAGGCTTCATCATGGCCAGGAAGTTGAT
CCACCTTGAGATTAAGCCAGCAATAAGGAATCAGATCATC
AGAGAGCTGCAGGTGCTGCATGAATGTAACTCTCCCTACA
TCGTGGGCTTCTATGGGGCTTTCTACAGCGACGGAGAGAT
CAGCATCTGTATGGAGAACATGGATGGCGGCTCTTTGGAC
CAGTGCCTTAAGAAAGCAGGCAAGATCCCAGAACAAATAC
TGGGCAAAGTTAGCATTGCGGTGATTAAAGGTCTGTCATA
CCTGCGGGAGAAACACAAGATCATGCACAGAGATGTAAAG
CCATCTAACATCTTGGTCAACTCGCGTGGGGAGATCAAGT
TGTGTGACTTTGGTGTGAGTGGACAACTCATTGACTCCAT
GGCCAATTCCTTCGTGGGAACCAGGTCCTACATGTCTCCC
GAACGCCTTCAAGGCACTCACTACTCTGTCCAGTCTGACA
TATGGAGCATGGGTCTCTCTCTGGTGGAGATGGCCATCGG
ACGCTTCCCGATCCCACCACCTGATGCCAAAGAGCTGGAA
CAAATCTTCGGTCAGCCCCTGGAGGGAGACCCATCAGCCA
GTGACACTTCTCCAAAACCCAGGCCCCCTGGTCGACCTGG
CAGCTCATACGGTCCAGACAGCAGACCTCCCATGGCTATA
TTTGAGCTACTTGATTATATTGTCAATGAACCACCTCCAA
AGCTACCAAGTATCTTTGGTGCAGAATTTCAAGACTTTGT
AAACAAATGTTTAATCAAAAATCCAGCAGAAAGAGCAGAC
CTCAAGCAGCTGATGGTTCATTCGTTTATCAAGAACTCAG
AGGCTGAGGAGGTTGACTTCGCTGGATGGTTGTGCAGCAC
CATTGGACTGAACCAGCCAGCAACTCCGACTCACAGTGTG
GGAATGTGAAAACAGCCATATTTTTCTAAGCCAACTGTTG
GTGTTTCTTCACCCTCAAAATCTTCAGTTCCACCCAGAGG
TCAACAGCAAACTACTGCCTCCTGAATCCACCCAGTCTTA
TTTTAGGTGTTGTCTAAGTATTAACAAACACACTGCTGTA
ATTAACAAAACATCACATCACAGTGCACTCAAAACCTGTT
CTACAACATATCGGTTGGTTTATGCTAGGATGGCATCTGT
GAGAGATGACAAATACCTATTTTTTCCTTACACCAAAATC
TCAATTGCAAAAGCTATCAAATGGCAGACGTTACACCGCG
CAAATGCAAAAGACCTCCCTTCTAAATGTCCACTTGTGAT
TGATATACTTTTTAAACTTAAAGATTTATGATTGAAGTCT
TTGACCCCAGAGATGCTTACGTGGTTTTATTGTAATGTTG
TGTTCTGCTTTCAGTATGGTGAATTTGCAGCCTTTAATTC
AAAGAGAGTGAAAAATCAGTCATTTAACTTATACAAATGT
GTATACTATGATAGGATTTATTTAACAGATGGCAACCAAT
GGAACGTGGCAATGCTTATATTGTATGCAGTGAATTAAAA
TGGACAGATTTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
map2k1-201 Contained in:
[BAC] CH73-94F11 (1) (order this)

OTHER map2k1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030444 (1)
  • Ensembl_Trans:ENSDART00000025107 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC097064 (1) 2115 bp
    CITATIONS (2)