header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12644
Transcript Name: rpl4-201
Previous Name: rpl4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030426 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030426|OTTDARG00000023368|ZDB-GENE-030131-9034 rpl4|OTTDARP00000024792 rpl4-001 LG_ CT863714.10 Danio rerio protein_coding KNOWN, 1422 bp
GCAGACTTGGGCGGAAGTGACATATGTCGGATGGATCTGC
AAGTGCCGGTGGAGTGCTTCATTCTTCCTTTTCTTCCGTG
GCCGCCATCGAGTTAGGAGCGTGGTTCCTGGCGAGCCGTG
AAAACTTACAATAATGGCTTGTGCCCGACCGTTAATCTCG
GTCTACTCCGAGAAAGGGGAGACATCTGGAAAAAATGTGG
TTATGCCAGCAGTGTTCAGGGCTCCCATCCGCCCTGATAT
TGTGAACTTTGTGCACACCAACATGCGCAAGAACAAGCGC
CAGCCCTATGCTGTCAGCGAACTGGCCGGTCACCAGACCA
GCGCTGAGTCCTGGGGCACAGGAAGAGCTGTTGCCCGTAT
CCCCCGTGTGCGTGGTGGTGGTACTCATCGCTCCGGCCAG
GGTGCTTTCGGAAATATGTGTCGTGGTGGACGCATGTTTG
CTCCCACAAAGACCTGGCGTCGTTGGCACCGCAGGGTCAA
TGTTAACCAGAAGCGTTATGCCATGTGCTCTGCCCTGGCT
GCTTCTGCTCTGCCATCCCTTGTCATGGCCAAAGGTCACC
GCATTGAGGAGATTCCTGAGGTCCCACTTGTTGTTGATGA
TAAAGTTGAAGGATACAAGAAGACCAAGGAAGCCGTGCTT
CTGTTGAAGAAGCTAAAGGCATGGAACGACATTAAAAAGG
TTTATGCCTCTCAGCGTATGCGTGCCGGTAAGGGTAAGAT
GAGGAACCGAAGGCGTATCCAGCGTAAGGGACCATGCATC
ATCTATAACGAAGACAACGGAGTGACACGAGCTTTCAGAA
ATATCCCTGGCATCACACTGCAGTCCGTAAGCAGACTGGA
CCTGTTGAAACTCGCTCCAGGTGGTCACATTGGACGTTTC
TGCATTTGGACAGAGGGTGCTTTCCGCAAACTGGATGACC
TCTACGGCACTTGGCGCAAAGCTTCCACCCTTAAAGTGGA
CTACAACCTGCCCATGCACAAAATGAGCATCACAGATCTG
AACAGAATCATCAAGAGTGAGGAGGTCCAGAAGGCCATTC
GTCCTGCAAACCGCAAGATTAATCGCAGAGTGTTTAAGAA
GAATCCTCTGAAGAACCTCAGAGTGATGATGAAGCTCAAC
CCATACGCCAAGACAGCCCGTCGCCGTGCTATCATGGCAC
ACAACCCTGATGTCAAGGCCAAGATGCTGAAACCCAAGAA
GAAGAGGGTTGTGAAGAAGACCAAGGCTAAGAAGGCTGAA
GCTACTCCAGCTCAAGCTTAGAGCTCATAAACAAGACTAT
GGAGTGCACACATGATTTTCAAAATAAAACAACTGATGAA
AATTAATAAAATCTGTCCATTTTAATTCACTGCATACAAT
ATAAGCATTGCCACGTTCCATTGGTTGCCATCTGTTAAAT
AAATCCTATCATAGTATACACA

rpl4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rpl4-201 1422
ncRNA rpl4-002 (1)    Ensembl 813
rpl4-003 (1)    Ensembl 831
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl4-201 Contained in:
[BAC] CH73-94F11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030426 (1),  Ensembl_Trans:ENSDART00000060363 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC049520 (1) 1285 bp
GenBank:BC067580 (1) 1269 bp
GenBank:CN843977 (1) 889 bp
GenBank:DN597187 (1) 751 bp
CITATIONS (2)