Transcript

nkx2.4b-201

ID
ZDB-TSCRIPT-090929-12641
Name
nkx2.4b-201
Previous Names
  • nkx2.1a-001
  • nkx2.4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030423 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030423|OTTDARG00000023367|ZDB-GENE-000830-1 nkx2.4b|OTTDARP00000024789 nkx2.1a-001 LG_ CT573061.8 Danio rerio protein_coding KNOWN, 1151 bp
GGCAGCTTCAGCAAACCTGCTCGCGGGCTGAACCATGTCC
TTGAGCCCCAAACACTCAACGCCTTTCTCAGTGAGCGATA
TTTTGAGCCCGATCGAGGAGACCTTCAAGAAGTTTGCAGC
CATGGAGAGCAGCGCGAGCCTGGCGTCTCCTCTATATCGA
CAGAGTCAGGTGTCTCAGGCTAATTTGCAGCAGCACAGCA
TGAGCCATAACGCGTACCACATGCCGCACTCGCAGTTCTC
GCATAGCACCATGGGCGGATATTGCAACGGGACTATCGGT
GCAATGGGGGACCTGCCATCCTACCAGGAGAGCATGAGAA
ACGGCGCCACGGCCACGGCTTGGTACGGCTCGAACCCGGA
GCCGAGATACCCAACAATCTCCAGGTTTATGGGTCCCTCG
GCGGGCATGAACATGGGCACGTTACCGGGAATGGACGCCA
GTAAATCTATGGTAACTCTACACGCGGCGCCGCGCAGGAA
ACGGCGCGTGCTTTTCTCCCAAGCGCAGGTATACGAGCTG
GAGCGCCGCTTCAAGCAGCAAAAATACCTGTCGGCCCCGG
AGAGGGAACATTTGGCCAGCATGATCCATCTAACCCCGAC
GCAGGTCAAGATCTGGTTCCAGAACCACAGGTACAAAATG
AAGCGGGAGGCGAAGGATAAAGCGTCCCAGCAGCAGGACA
GCGGGAACATGTGCGCGCAGCAGTCGCCAAGGCGCGTGGC
CGTGCCTGTGCTTGTTAAGGACGGTAAACCGTGTCAGAAC
GGCTCCGGCACGCCGACGCCGATCCATCAACAGGTGCAAA
GCGTCCTGGGCAGCGAGACTTTAGCTTCAGCCGAGGATCT
GGAGGAAATGTCGCCTAGTCCGCCTCTGATGGGCGGCCTC
TCTCAGACTGACGCCGCGCTCATCGAGTACACGAGCAGCA
TGGTGAGCTCCAACCTGCTGTACGGCAGAACATGGTGATA
TTTCACAAACTACAACAACAACAAAAAAAATCCTCATTTT
TAATCAACCGACGGACGGAGATATGTGCATTTCCACAAAG
ACCTTTTTTTAAAGAATTGTTTTTTTATTTTACGCACTTG
CTTTTTGGTGCAGGAGCCTCTTTGACGTGAATTGTATACG
GATTTGTGAGTTTAAATCATTATTGACTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations