header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12549
Transcript Name: cdkn1a-201
Previous Name: cdkn1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030315 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030315|OTTDARG00000023293|ZDB-GENE-070705-7 cdkn1a|OTTDARP00000024700 CH1073-48M5.2-001 LG_ CU062631.4 Danio rerio protein_coding PUTATIVE, 1029 bp
CTCTCAGTCATGACAGCTCAGAGGCGCAGAGCTCGCGTGG
AGTCAGCAATTGTCACAATGGCGGCGCACAAGCGGATCCT
ACGTTCACTCGGTAATGGGCCGACTAGGCGGAGTCTTTTC
GGGCCGGTGGACCGCGAGCAGCTGCAGCGTGAGTACCGGG
CGGCGCTACGGCGCGATCTGGAGGACGCATCGCGACGCTG
GAGCTTCGACTTTGCGTCTGAGAAACCACTAGAGGGCGGA
GACTTCCACTGGGAGGGCGTGTCCGGCGTGCGCGTGCCAC
TACTGTACCGCGCGTGTCAGGAAAAGCAGCAGAAACGGCC
CTGTGAGGCTCATCAGCCCGGACAGTCCGCCGCTGGAAAG
GAAAACATCCCGAAAACACCAGAACGATGTGCTGCACTCC
CGCATGAAGTGGAGAAAACCCCAGAGAAGAGCAGCGAGCT
GAAGCGCAAACAGACCAACATCACAGATTTCTACCAAGCC
AAGAAGCGTCTAGTGGCCACGCCGCGCAAATCCGGCCAGT
AGCTGAAGGAGACACACACACACACAGATAAACTCTTGAC
CTGCATCTACCTTCATCTGTCTGGAGCTGCATTCGTCTCG
TAGCAGCGTTATTGACAGAAAACGACCTTCAGGAACCAGA
GACGACACCGTTTATTCCGTTTTTATTTCAACCGTTTTAT
GTCAACGGTTAACATTTACAAGTGGAAATGTTCTGGAAAG
ATCCATTCCTCAGTCTTCCAGAGATTGTCTCTCGACGGGA
CCACAGAATCATGACAACTGTTTCATTACGAACAATATAA
AGCGCTGATTTTTATTTCAGCGTGCACATATTCACATTGC
CTTATTGCACAAAACGTAGCTAATGTTTTAAAACTCTAAA
CATTTGGTGCCAAATGTTGTTTTTTCCTCTTCTTCTATTT
ATAATTCTAACCCTTTATGTTATTTTACACATAAACCTTC
ATGAAGCTGCCAGTAAGTTCTCACATCTTTATCGTAATTG
AGCTGCAATTACGTTTTTCTACTACATTA

cdkn1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cdkn1a-201 1029
cdkn1a-202 (1) 834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdkn1a-201 Contained in:
[Fosmid] CH1073-48M5 (1) (order this)

OTHER cdkn1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030315 (1)
  • Ensembl_Trans:ENSDART00000136722 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DV597986 (1) 810bp
    GenBank:AL912406 (1) 417bp
    CITATIONS (2)