ZFIN ID: ZDB-TSCRIPT-090929-12420
Transcript Name: ccnt1-201
Previous Names: ccnt1-001, si:dkey-18f23.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030162 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030162|OTTDARG00000023191|ZDB-GENE-030131-6397 ccnt1|OTTDARP00000024573 DKEY-18F23.10-001 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 2826 bp
TTTTAAAACATTGTCCTTCTCAGTAATGGCGGCTTCGTTC
CCTTCGCCTTCGCAAAATAACAATAAATGGTACTTCACGC
GCGAACAAATCGAAAACAGTCCATCTCGCCGAGCGGGACT
TGATCCCGACAAAGAGCTCTCGTACCGACAGCAAGCTGCT
AACCTGCTGCAGGACATGGGACAGCGGCTCAACGTCTCAC
AACTCACAATTAACACTGCCATTGTGTATATGCATCGCTT
TTACATGGTCCAGTCCTTTACTCGCTTCCACCGGAATGTG
ATTGCTCCTGCAGCTCTGTTTTTAGCAGCGAAGGTGGAGG
AACAGCCCCGTAAACTGGAGCATGTGATTAAGGTGACCCA
TGCATGTCTCAATCCTCAGGACCCATCACCGGACACCAGG
AGTGATACATACCTGCAACAAGCCCAAGACCTGGTCATTC
TTGAGAGCATAATACTCCAGACCCTGGGTTTTGAGATCAC
CATTGATCATCCTCACACACATGTTGTCAAGTGTACTCAG
CTTGTGCGAGCGAGTAAGGATTTGGCTCAGACTTCATATT
TCATGGCAACAAACAGTCTTCACTTGACTACGTTCTGTCT
GCAGTACAGTCCACCAATTGTAGCTTGTGTTTGTATTCAT
CTGGCCTGTAAATGGTCCAACTGGGAGATTCCCGTTTCCA
CAGATGGCAAACACTGGTGGCAGTATGTTGACCCCACTGT
GACTCTTGAGCTATTGGATGAGCTCACTCATGAGTTCCTG
CAGATCTTGGAAAAGACACCCAGCCGCTTAAAACGCACCA
GAAACTGGAAAGCTGCAGGTCAAACTGCTAAGAAATCGAA
AGTGCAGGATGGCGATCAGTCTGAAGCCATCATGAACATG
ATCTCAATGTCGTCGTCCGACAGCACATTGGCAGGACTGA
CGAGCCTCTCCGCTCCGCCCACCGGTTCCTCCATGGACTC
TTGTGCAGACGAGCACAGCGCCGCAGCCTCCGCTCAACAC
TGGCAGCCTCCCAGCAAAGAGCAGCCCACTGCCAACGAGC
TCCACGCACCCGCCAAAGTCTCTCTGAGCGAGTATCGGGC
CAAACATGCGGATGAGTTGGCGGCACAGAAGAGGGAGCTG
AAGAACATGGAGGCAAGTGTGAAGCAGGGATACGCCACTG
CCGCCCAGGCCCTAATGAACCAGCAGAGGAAAGATAAACA
CCATCACCACCAGCAGACCAGCTCCTCAGACACCAACAAC
CCATCCCCAATCGTCTTGAAGATCCCGCTGGATGAGCGAT
CGGAGAGAAGTTCCATAAAAATGCGCTTACCTGTGCCAGG
TCAATCCGGCGGGGGTCACAGCCACAGCAGTGGCAGCAGC
AGCCGGGGATCAGACCAGGACATCAAAGTGCGCATTCGGG
TTCCAGACAGGCGAGGCGGATCTGGAGAAGACGGGAAAAG
TCGCGAAAAACACAGAGAGCGATCCAACCACCACCACCAT
CATCACCACCACCACCACCACTCTTCCTCCTCCAGCGCCG
GTTCCCTCTCAGCATCGTCTTCCTCATCCTCAGCACAAAA
ACACTCAGCCGGCTCTTCAGGAAGTAGCAAAAAGCTCTCA
GGTGATTCAGTGCGGACGAGCTCTTCATCAATGTCGCGAA
AACGAACCCACATGCCAGACCCTTCCTCCTCCAGCACCCA
CTCGTCCTCAAAAGTCAGCAAATCGTCCAGAAACTCATTT
CAGTTGCCCACGCTCCCTGGATTGCCGTCTCATGTGATGC
CCGACATCCTTCCCTCGCTGCACCATCAGGGAAACTATTC
GCACTCCAAGACGGACAAAGCGGATACAAACGGTCACAAC
GCGGCCGGACAGTCGAACGAGTACCAGGACACGTTTGACA
TGTTGAACTCGCTGCTCAGTGCGCAGGGCGTCCAGCCGGC
ACAACCTCAGATATTTGACTACCGCTCTCAGTACGGAGAG
TTTCGCTATAGCAGTGGCGCTCGCGGAGGAGCACAGCCGC
CACCTTTACCCTCAGAACCACCTCCACCTCTGCCTCCATT
GCCCAAATAAAGCGCCCTCGCATCATCCGTCCACACACGC
TGATCAAATCAGTGCTTTCGGGAGTCCTGTGTGCGTCTAA
CTTTAGTGTGATGTCGCGTTTGACAGCAGAGTAATGTAAG
GCAAAAAAAGCCCTAATGTTGTCTTGCGTCTTTGTGTGTG
TGTGCGTGCGCAAGCGAGTACGTTCACAACACCCCATCTG
TGGCAATAATGTTAAAGTAGAACAAAATATTGCAAAAAAA
AGGCAAAAATGTTATTTATTGAAACGAGAAAAAAAATAAT
TGTACATACTACTATTTTTTGATGTCGTTCACTTTTATAT
CCGCGCTAACAGAAAAGCATAATGGAATTAAGGGTAATGT
ATTACTGAATGAGAGGGACTCGCGGTCCTCTTTAAAAAAA
AAAAAGTGTAACCTTGAATGCAAAAATGGAAAATGTTCGC
TAACAATATATATGTGTCTTTTTTATGGAGTATGGTATTT
ATTATTAGCCTTTTAAATCCATAGTTATTAGCAGTCGTTG
CTTGAATGCGTCTCCAGACGAGATCTGGATTTATTTTTAT
ACTGTTGTAAGTAAACCTACTTCCCAGTCTGTATTTACTT
GATGTGTGTCATGAGAAATGGACACGCACACAAACACAAA
TCACCAATATTCGCATCATAATGTGTTCCTAAATTCACGA
ATAGTTTCATTTTTGTTTTGTTTGGTAAATATTTTTGCTT
TCAACTTCTATTAATGGTGAAAATTGACGACTATTTAAAA
GAAAAAAACCTAAAAAAAAAAAAAAA

ccnt1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccnt1-002 (1) 1136
mRNA ccnt1-201 2826
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnt1-201 Contained in:
OTHER ccnt1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030162 (1)
  • Ensembl_Trans:ENSDART00000005158 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC057477 (1) 2828bp
    GenBank:BC044435 (1) 2277bp
    CITATIONS (2)