header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12421
Transcript Name: ccnt1-002
Previous Name: si:dkey-18f23.10-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030163 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030163|OTTDARG00000023191|ZDB-GENE-030131-6397 ccnt1|no_translation DKEY-18F23.10-002 LG_ BX465853.12 Danio rerio protein_coding KNOWN, 1136 bp
GTTCCCTTCGCCTTCGCAAAATAACAATAAATGGTACTTC
ACGCGCGAACAAATCGAAAACAGTCCATCTCGCCGAGCGG
GACTTGATCCCGACAAAGAGCTCTCGTACCGACAGCAAGC
TGCTAACCTGCTGCAGGACATGGGACAGCGGCTCAACGTC
TCACAACTCACAATTAACACTGCCATTGTGTATATGCATC
GCTTTTACATGGTCCAGTCCTTTACTCGCTTCCACCGGAA
TGTGATTGCTCCTGCAGCTCTGTTTTTAGCAGCGAAGGTG
GAGGAACAGCCCCGTAAACTGGAGCATGTGATTAAGGTGA
CCCATGCATGTCTCAATCCTCAGGACCCATCACCGGACAC
CAGGAGTGATGTTTTGAGATCACCATTGATCATCCTCACA
CACATGTTGTCAAGTGTACTCAGCTTGTGCGAGGTGAGAA
CCAGCTGCTCACTCTAAACTGTGCTTCGTATTGCTCAGTA
AAGGGTACGTCTAGCACACCAAGCTCACAGATTTCACGTC
TGATCATGAGCTTTCCTTTTATTGTTCCAGCGAGTAAGGA
TTTGGCTCAGACTTCATATTTCATGGCAACAAACAGTCTT
CACTTGACTACGTTCTGTCTGCAGTACAGTCCACCAATTG
TAGCTTGTGTTTGTATTCATCTGGCCTGTAAATGGTCCAA
CTGGGAGATTCCCGTTTCCACAGATGGCAAACACTGGTGG
CAGTATGTTGACCCCACTGTGACTCTTGAGCTATTGGATG
AGCTCACTCATGAGTTCCTGCAGATCTTGGAAAAGACACC
CAGCCGCTTAAAACGCACCAGAAACTGGAAAGCTGCAGGT
CAAACTGCTAAGAAATCGAAAGTGCAGGATGGCGATCAGT
CTGAAGCCATCATGAACATGATCTCAATGTCGTCGTCCGA
CAGCACATTGGCAGGACTGACGAGCCTCTCCGCTCCGCCC
ACCGGTTCCTCCATGGACTCTTGTGCAGACGAGCACAGCG
CCGCAGCCTCCGCTCAACACTGGCAGCCTCCCAGCAAAGA
GCAGCCCACTGCCAACGAGCTCCACGCACCCGCCAAAGTC
TCTCTGAGCGAGTATCGGGCCAAACATGCGGATGAGTTGG
CGGCACAGAAGAGGGA

ccnt1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ccnt1-002 1136
mRNA ccnt1-201 (1) 2826
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccnt1-002 Contained in:
OTHER ccnt1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030163 (1)
  • Ensembl_Trans:ENSDART00000132609 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CF550193 (1) 957bp
    GenBank:EB932328 (1) 649bp
    GenBank:AW059260 (1) 532bp
    CITATIONS (2)