ZFIN ID: ZDB-TSCRIPT-090929-12419
Transcript Name: nr1d4a-201
Previous Name: nr1d4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030161 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030161|OTTDARG00000023190|ZDB-GENE-080403-5 nr1d4a|OTTDARP00000024572 DKEY-18F23.6-001 LG_ BX465853.12 Danio rerio protein_coding NOVEL, 1986 bp
ATACTAGAATCAAGAGCAGAAAGAACAGGTAGCTGCGCGC
GGAAGGTGCATCTGCACACCTGTGAACGACTCGATATTTA
CTCCCGACTGTTTGGCTGCGCTGCCAAATGTTCTCAGCGA
GAGACTCTGCCTGCCTACTTTGGGCTGTTCACTGTATTCA
CAGGCAATGCGTGGCTTTTTAAACTGATTTACCTGAATTG
ATCACACTGACATTCACAGACCATCTTGAAGATACGAATT
CTGAAGATAGAGGCGTTTGAAAACATATCAAGGATGGATA
GCAGTCCTGGGAGCGTGATTCTCTACGCTGGTTCCAGTGG
CAGTTCCAGTCCAAGTCCAGGAAGCCCTTCAAGTGGTTAT
CAAACCCAGTCTCCATCCTCTCACTCCCAGCCTTCTTCCC
CAGAGGAGGTGACCTTCACCGAGATCGGGGCCTTCAAGCA
GCAGGGAAATGCTGGATCACCAAATTCTCCAAAACTGGTC
TTTCAGTTCCCTGAAATCTACAACAACTCCACAGCAGGTC
CAAACCCGCACAGCTACTCCCACCCTATCGCCGGTAAAAG
GCCTTGTGGATTCACTGGCACATTTACCAAGACGGGAGGC
ATGGTGCTCCTTTGTAAAGTATGTGGAGATATTGCATCAG
GGTTCCACTATGGTGTCCATGCATGTGAAGGCTGCAAGGG
CTTTTTCCGCCGCAGCATTCAGCAGAACATCAACTACAAG
ATGTGCGTGAAGAACGAGAACTGCCTGATAATGCGCATGA
ACCGCAACCGCTGCCAACACTGCCGCTTCAAAAAATGCCT
GTCCGTTGGCATGTCCCGTGACGCTGTGCGTTTCGGCCGC
ATCCCTAAACGTGAGAAGCAGCGTCTTCTGGATGAGATGC
AGAGCTACATGAACAGCCTCAACGAATCCTCCATGGGCAT
GGAAACCTCCCCACAACATGAACCACCACCCAGCCCGATT
GAGAACCAATCCAAAGAGGCCATCGGTGCCTTATCCCGAG
CCTACCAGGACATCTTCACCAACACACAGGACCACTTGAA
CAAGCGTGCAGGGAACAACAACATCAGCAGATCGAGCAGC
TATCAAAACAGCCCTTCTCAGGACAGCAACTATCCTCATG
CCAACCCTCTTGCTGGGTATCACACGACCACTCACGAAAG
CTTCTCAGGCCCGGTTCGCTGTCCAGTTTCCACCAGTGAG
AGCAAATGCCCGGTGTCGTTAGTGGACAACAATCGGTACA
GCTATGCTCCTTCATTCAGCCAAAATCACTCCCAGTCCAG
TGTTAACCAGCCCTCACAACCCACTCAGGCCCATTACAGC
AGCTACACAGCCAGCCAATCCCAAAGCCCAGCCTCGTGTC
CGTTCAAGCTGGCTGCTGGCTCCAAAGTGCTGGCCTGTCC
ACTGAACGCCTGCCCTGTGTCAGCTCCTGGTGTTTCCAGT
CAGCAGGTGTGGGAGTCTTTCTCACAGTGCTTCACACCGG
CTGTACGTGAAGTGGTGGAGTTTGCGAAGGGCATTCCAGG
CTTCCAAGAGCTCTGCCAACACGATCAAGTCATGTTGCTC
AAAGCGGGCACTTTCCAGGTGCTTATGGTGAGGTTTTGCT
CACTGTTCAACCACAAGGAAAGATCTGTGACTTTCCTCAA
TGGGCAGACGTACCCGCTGGGCACCCTCAGGGGTCTGGGC
ATGGGCTCACTGCTGGACGCCATGTTTGAGTTCAGTTCCA
AGCTGAGCTCTCTGGGCCTGGAGTCAGATGAGATGGCTCT
CTTTATGGCTGTGGTGCTGGTTTCTGCAGATTGCTCTGGC
ATTTCGGATATGTTGGCGGTTGAACAGCTCCAGGAAGGAC
TCATCCGAGCTCTGCGCACTTTAATCAACCGTCGACACCC
CGACGACAACTCGCTCTTTTCTAAACTTCTCCTGCGCCTC
CCAGACCTGCGCACCCTCAACAACCTCCACTCCGACAAGC
TGCTGGCCTTCCGCATTGACCCATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nr1d4a-201 Contained in:
OTHER nr1d4a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030161 (1)
  • Ensembl_Trans:ENSDART00000103169 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO933134 (1) 924bp
    GenBank:EH432250 (1) 883bp
    GenBank:EE211080 (1) 446bp
    GenBank:EE207687 (1) 445bp
    GenBank:EE208098 (1) 421bp
    CITATIONS (2)