ZFIN ID: ZDB-TSCRIPT-090929-12390
Transcript Name: sfrp1a-202
Previous Name: sfrp1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030130 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030130|OTTDARG00000016470|ZDB-GENE-040310-5 sfrp1a|OTTDARP00000024546 sfrp1-002 LG_none CT990639.10,AL954699.4 Danio rerio protein_coding KNOWN, 524 bp
CAGAGTGTATCCGGATCAAATGTGGAGAAGGTGCAGATTG
CATCCTCGAATTGAACTAAAGTTTTTAGGAATTAGGTCCA
GAGTTTTCTAACACTGACACGAATTTAAATCCAGTGGAGT
ATTCCGCGTTTTCAGCAGAATGGCACCCATTGACTTGCAT
TATTGAAACCATCAAGGATTTACTGAAGAAAAAGAATCAT
TTGCGTCAAGAATGGGACACCCTCCAGTTTGTCCCCCTTG
CGACAATGAAATGAAAATGGATGTGATTCTGGATCACATG
TGCGCCAGTGAGTTTGCCATTAAGACCAAGATCCAAGAGG
TCAAGCGGGAGAACATGGATCGCAAGGTGACCCTTCAGAA
AAAGAAAAGAACCATAAAGATGGGCACTTTGAAAAAGAAG
GACCTTAAGAAACTGACTCTGTACCTGAAGAACGGGGCGG
ATTGCCCCTGCACACAGCTGGACAATACCCGAAACACATA
CCTTATCATGGGACGCAAGGTGGACAAACAGTACCTTCTC
ACCG

sfrp1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sfrp1a-201 (1) 1577
sfrp1a-202 524
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sfrp1a-202 Contained in:
OTHER sfrp1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030130 (1)
  • Ensembl_Trans:ENSDART00000123635 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI722089 (1) 524bp
    CITATIONS (2)