ZFIN ID: ZDB-TSCRIPT-090929-4584
Transcript Name: sfrp1a-201
Previous Name: sfrp1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019805 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019805|OTTDARG00000016470|ZDB-GENE-040310-5 sfrp1a|OTTDARP00000016735 sfrp1-001 LG_none CT990639.10,AL954699.4 Danio rerio protein_coding KNOWN, 1577 bp
AAGCAGCTCCGCCGTGCGAGTCAGCAACAGCTACGGGGCT
TCAAAAGGGTGGAGTTTCCACCGCTTCACCACTTTGACTT
CGGAGTCTTATAAAATTCAGAGGTATTTGTCTCTCTCTCT
TCCCATTCTCTAGACAAAGAGGACTTGATTTTACTCTTAA
GGCTCACAGTTTTCAGGGGTTGCTTTGACTGGAGTTCCTG
AGCAGGAGTCCACAATGAAGTCCCTTGCATCTTTGTCCCT
TTGGAGGATCATCATTTTGATACTGCCACTGGTCTCTTTA
GGCCAGACATTTGAGTATGGCTGGCCTGATAACTATGACA
AGCCACCCCAGTGTGTGGACATCCCAGTTGACCTGAGGCT
TTGTCAAGGTGTGGGCTATCACCAGATGCTGCTGCCCAAC
TTGCTGGAGCATGAGAGTATGGCTGAGGTCAAGCAGCAAG
CGGGCAGCTGGGTGCCTCTGTTGCATAAGAACTGCGACCC
AGGCACTCAGTTGTTGCTGTGCTCCCTGTTTGCCCCTGTG
TGTATGGAGAGGCCCATCTACCCTTGCCGCAGGCTCTGTG
AAAATGTGCGTGATGGCTGCTCTCCCATCATGGCAGCATT
CGGGTTCCCCTGGCCTCATATACTCACCTGCGACAAGTTT
CCTCAAGATGACATGTGCATCAACACACCCAATGATACTT
CCACCTCCGAACCCAACGGACACCCTCCAGTTTGTCCCCC
TTGCGACAATGAAATGAAAATGGATGTGATTCTGGATCAC
ATGTGCGCCAGTGAGTTTGCCATTAAGACCAAGATCCAAG
AGGTCAAGCGGGAGAACATGGATCGCAAGGTGACCCTTCA
GAAAAAGAAAAGAACCATAAAGATGGGCACTTTGAAAAAG
AAGGACCTTAAGAAACTGACTCTGTACCTGAAGAACGGGG
CGGATTGCCCCTGCACACAGCTGGACAATACCCGAAACAC
ATACCTTATCATGGGACGCAAGGTGGACAAACAGTACCTT
CTCACCGGGATTCACAAGTGGGACAAATCCAACAGAGAGT
TCAAAAAGACCATGAAAAAACTCAAAAGCCACAAGTGCCC
TGCCTATGAGAATGTCTTCAAGTAAACATTCTCAAAGCTC
CCACTTACTTTATGAACTTGCACATCCAGGCAACCCCCCA
AAAATTGTTTTATTTTTCATATATATATTATATAATTTTT
TCATCTATTTTATAAATCAACCACACGCGAGGTGTTTAGT
CTTGGATTTGTGCCATTTAAGACTGAAAAGATAACGAATA
AGGCCGTAGACAAACTCTCAAACAAAACCAACTGATCACT
TTTGTATATATCCAAATAACTGTTGATAATATCTTGTGAA
AGAAATCTGAATTCACCTGCAATTGATTGTTGACTTTTCT
TTTTAGTTTTTCTATCAAAATAATAAAACACTTAAACAAG
ACAAATCTCCAACCTATAGTTACACCTGCTAATAAAGGGA
TAGTTCACACAAAAATGGAAATGCACAGATTTACTCACCC
GCAAAAATTTGAGCTTCTTTATTTTGTTGAACACAAAATA
ATATAATTTGAAGAAAG

sfrp1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sfrp1a-201 1577
sfrp1a-202 (1) 524
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sfrp1a-201 Contained in:
OTHER sfrp1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019805 (1)
  • Ensembl_Trans:ENSDART00000051491 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY307179 (1) 1549bp
    GenBank:BC108047 (1) 1292bp
    GenBank:CF266297 (1) 895bp
    GenBank:CD053112 (1) 774bp
    GenBank:CF998101 (1) 756bp
    GenBank:BI979475 (1) 555bp
    GenBank:BI883432 (1) 548bp
    GenBank:AI626238 (1) 508bp
    GenBank:BI883424 (1) 503bp
    CITATIONS (2)