Transcript

sik2a-203

ID
ZDB-TSCRIPT-090929-12368
Name
sik2a-203
Previous Names
  • sik2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030096 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030096|OTTDARG00000023161|ZDB-GENE-070705-451 sik2a|OTTDARP00000024541 DKEY-27P23.1-001 LG_ BX950179.6 Danio rerio protein_coding NOVEL, 2529 bp
ATGGTCATGGCCGCTCAGGACCAAAAGCCGTTGCAACGGG
CTCCGGTACGCGTAGGATTTTACGATATTGAGCGCACACT
GGGAAAAGGCAATTTTGCAGTTGTGAAGCTGGCGAGACAT
CGAATCACAAAATCTGAGGTGGCCATTAAGATCATAGACA
AAACCCAGCTAGATGCGGTGAACCTGGAGAAGATCTACAG
AGAAGTGGAAATCATGAAACTGCTGGACCATCCTCACATC
ATCAAGCTTTACCAGGTTATGGAGACCAAAAACATGCTCT
ATCTAGTCACAGAATACGCCAGAAATGGAGAGATATTTGA
CTACCTGGCCAGCCGCGGGCGGCTCAGTGAGGTGGATGCG
AGGAAGAAGTTCTGGCAGATCCTCTCAGCGGTGGAGTACT
GCCACCAGAGAAATATCGTACACCGAGACCTGAAGGCTGA
GAACCTGCTCCTGGACACTCATATGAACATGAAGATAGCA
GATTTTGGCTTTGGGAACTTTTTCCGTCCAGGGGAACCCC
TGACAACTTGGTGCGGCAGCCCCCCTTATGCAGCTCCAGA
GGTGTTTGAGGGGCAACAGTATGAGGGTCCACAATTGGAC
ATCTGGAGTATGGGGGTGGTTTTGTACGTGTTAGTGTGCG
GCGCTCTTCCATTTGATGGCCCTAGCCTTCCTGTCCTCAG
ACAGAGGGTCCTTGAGGGTCGTTTCCGCATCCCATACTTC
ATGAGCGAGGACTGCGAGCACCTGATCAGGAAGATGTTGG
TTCTAGATCCAGCCAGGCGTTTGTCTCTGAGTCAGATTAA
AGAGCATCGCTGGATGGTGCAGGAGGTCCCGTCCCAGCGG
CCTGTGCTCTACAGACAGGGTTTGCCCTGTGAAAGTAAAT
CAGGTTTGGGGGAGCACAGTGAGCAGGTGCTTCGCCTCAT
GCACAGCCTGGGAATTGACCAGCAGAAGACCATTGAGTCT
CTCCAGAACAAAAGCTATAACCACTTTGCTGCTATCTACT
ACCTGCTGGTGGAGCGGTTGAAGGCGCATCGCAGCAGTTT
CCCTGTGGAACAGCGTTTGCACGCCAGCCAGCGCCGCCCC
AGCACCGTCGCCGAGCAGACTGTTGTCAAGACAATTGCGG
TTCCCTCTCAAGCGGGCGTCCCCCCTCAGGCAGCGCGTCA
ACTGCGTTCACCTGTTTTGCTGCAGTCCACCGCAGAAACC
TTTACCTTCCCACAAAGCCCTGCTTCCCCAGATCAGACGC
TCATGGAGGAAGACGTGGCTACTCCTAAGGTGGACGGCTG
CTTGCTGGATCCGCTTCCTCCAGTCGTGGTCCGCAAAGTC
AGCGGCTCGCTGCCTAGCAACGTTATGGAGACATCCATTG
ATGAGGGCATTGAAGCGGAGGAAGAGCACACTGTTCCCCT
CGCCGCCTTTCATACAGCTCGATTCAGCCAGCGCCGCCAC
ACGCTGTCTGAGGTCACCAACCAACCTGCTGCGCAGCCCC
TTACAGATCTGAACCCGTCCCTCAGCAGCATGGACTCGCA
GTACAGTATGGGTTCAACTCAGAGCGACTGCAGCTTTCCT
GAAGAGAGTCCAGCATTAAACTCTACACCTGCCGGCTCCA
CAGCTCCAGTCTTCCTCAGCATGAAGCCGCCTGAAGCCTG
CCTGCAGACGCTCAATCCACAGGGACACAATCACTCATTA
GTCAGCTTCCGAGAGGGGCGAAGGGCTTCAGACACCTCTC
TCACACAAGGGTTGGTGGCATTCAGACATCACATCCAGAA
CCTGGCCAGGACCAAGGGCTTCCTGGAGCTCAATAAAGCA
CAGATCGTGTTAGGAGATGGTGGAGCATGCGGAAACACTA
TGATCAGCCCTCGGGAGCTCCTAGAGCCTCACCATCCGCT
CAACCACCAGGGAGAAGGACGGCCATGTCTTGGTGGAAAA
GATCCATCGACATTCACTGGAAAAATGCACCCTTATTTGC
TGTCTAGGAGACAGAGTCTGGAGACACAGTACCTCACTCA
ACGCCTACAGAGAGCCAGTCAGTTGGCAAGCGGCCTTGGA
AGTGGCCAGATGTTTTGTAAAGAGGCTGCACCGCGCACTT
TAGAGCAACAACTCCAGGAACACAGACTCCAACAGAAGAG
GCTCTACCTCCAGAAGCAGTCTCAGGTTCAGGCTTACTTC
CACCAGATGCAGCTGGCTGAGGACGCTTACCCTGCCCAGG
ACCCTCAGATCAGCAGCAGCCCCCAACCCAGCCCTCCCTT
TACAAGGACCCAAACCCTAACCCCTTTTTTGGAGCCTGGC
ATCTCATCCCTGTCATACAGTCCCAAGTCTGCCCGCTTCC
CAGAGTGGCCTCCGCCACCCGAAAACCTCAGCAACTACAC
CCCATCCCTTCCTACAGAGCCCCAGTACGCATGGAGTCCT
GCCCAGCCTCCTCTGCCCCCAGGTAAAGCTGAGACCCCTT
CAGTTCAACCCGCACCTGAAGCCCCTTTCCTGGACTGCGA
GATGATGGAGACCGTAGAGGCTCCACAAGGCTGTGTCCTC
GTGAACTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations