Transcript

exo5-202

ID
ZDB-TSCRIPT-090929-12197
Name
exo5-202
Previous Names
  • exo5-002
  • zgc:123272-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029819 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029819|OTTDARG00000022957|ZDB-GENE-051113-108 exo5|OTTDARP00000024328 CH211-198E20.3-002 LG_ BX908796.11 Danio rerio protein_coding KNOWN, 1565 bp
ATCAGCAAATGAAATACAAACATTAGCAGCAAGCGAAGAA
AGATGTTGTTGACAGAGGCGGGGCATTGACGGAAGTTGTT
CGGGCATGTCTCATGTAAACAATTCAAACTTAAAATAAAA
ACAAATTAAAATACAAACTAGCATCGTGTTTAAGTTCCTG
CAGCATTGGTGTAAAGTGCACAATGGGCTGAGAGAACAGT
TTGAGTTTGCTTTTATGATGGATGCGTCTAGATCACAACA
ACCGCTGGATGCCTGGGACGACATTAGCGACTCTGAGTTT
CTTAACATCCCTTCCGACGAAGAAAGTATAGAGTCCCAGC
TTCCTCTTATCGGAGAAACTAAAGGTAAACATTCAGTGAA
CTTGGACAAACCCAGTTCATCTTCATCATTTCACAAGTGC
AGTGAAGAAGCACCGAAGCAAGAAGCAGTGAAAACTGATG
ATGTGAGGGGTTTAAAGAGAAAGAGCCTCCACGAAAACAG
CTTCAGCCCAATGCAACGCTTCCGGAAGCAGCATCTGAGT
GTGACCCTCCTGTGTGACCAGACTTGGTGTGAGATGAAGA
GCGTTTACAATCTTTTGAAGCCCCATATCAAGAGAAAAGA
AATGCAACGCACTGAGGTGCAAATCGGACAAGAAATTCAT
TTATCAAGGGAATTGGAAATACAGGATGTTGTCCCAGTAG
ATATCCGCACTAGAGAGGATGGAGAAGCCGTCAAACTTCT
CAACATGCTACACATGATCCCGCTGTTAGAAGCAGGACAG
CGTGTGCGAGAGTTCCCCGTGTTTGGTGTGCAGGAAGGTG
TTTTCATCATGGGGGTCATTGATGAACTCATGTATAACCA
GAAGGGGGAGCTGGTGCTGAATGAGCTCAAGACACGCAGA
CAGAACTCCTTGCCCAGTTCTGCACAAGATAAAGTCAACT
GCTTTCAGGTGGGCCTGTATAAATTGCTCTTTGATGGACT
GGTCAGAGGGGAGATGAAAAAAAATCACATTTTCGATCAC
CTCAAACTGCGTTCTGCTCAAATTCTCGGTGCAGGCGTCC
AGGCTCATGCTAAAAACCTTGGGGTTCATGCCAGAACATT
TGAGGAGCTGGTTGAAACTTTGCTTATAACAGTGTCATGC
TCTGATCTTCCATGTATTGACCTGCTTCAGATTGAATACT
TTCATCAAGGCTCTAATGGGCCCATTGGGACAAGAGTGGC
TCCTTTTGATGAAGCCCAAATACGGGGAGAGCTTCAGGCT
TATTTGTCCTACTGGACGGGACAGAGAGAACCTAAAGGGG
TGGATATAGAGGAGGCCTGGAAATGCAGATCATGCCTGTA
TGAGGAGATCTGCGAATGGAGGAAGAACAGATTTACAGTT
TCTGACCAACAAGCGGCTCATTCTAGCTCACACTTATGAT
TTTACAGATCATATTTATATATTTGAATGTGCAGTGTTAA
TTATGCTTTTGACTTTTATACCTTGATTAATGTTTTCTTG
TTCTATTGAAGCATTTCTGTTTTTAAATCAGGATGTGAAC
ATTATTGTGCAGCTCTATAATAACTGTGATTGAAGTGCTT
TGACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations