Transcript

exo5-203

ID
ZDB-TSCRIPT-090929-12196
Name
exo5-203
Previous Names
  • exo5-001
  • zgc:123272-001
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029818 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029818|OTTDARG00000022957|ZDB-GENE-051113-108 exo5|OTTDARP00000038124 CH211-198E20.3-001 LG_ BX908796.11 Danio rerio protein_coding KNOWN, 1534 bp
AGGTAAAACATTGTGCAATTGTGGTAGTTTGTTGTGAATG
TGGTCATGTGACTTTATTTTCTGGACACAAGCGGAGTCCC
AGCTTCCTCTTATCGGAGAAACTAAAGGTAAACATTCAGT
GAACTTGGACAAACCCAGTTCATCTTCATCATTTCACAAG
TGCAGTGAAGAAGCACCGAAGCAAGAAGCAGTGAAAACTG
ATGATGTGAGGGGTTTAAAGAGAAAGAGCCTCCACGAAAA
CAGCTTCAGCCCAATGCAACGCTTCCGGAAGCAGCATCTG
AGTGTGACCCTCCTGTGTGACCAGACTTGGTGTGAGATGA
AGAGCGTTTACAATCTTTTGAAGCCCCATATCAAGAGAAA
AGAAATGCAACGCACTGAGGTGCAAATCGGACAAGAAATT
CATTTATCAAGGGAATTGGAAATACAGGATGTTGTCCCAG
TAGATATCCGCACTAGAGAGGATGGAGAAGCCGTCAAACT
TCTCAACATGCTACACATGATCCCGCTGTTAGAAGCAGGA
CAGCGTGTGCGAGAGTTCCCCGTGTTTGGTGTGCAGGAAG
GTGTTTTCATCATGGGGGTCATTGATGAACTCATGTATAA
CCAGAAGGGGGAGCTGGTGCTGAATGAGCTCAAGACACGC
AGACAGAACTCCTTGCCCAGTTCTGCACAAGATAAAGTCA
ACTGCTTTCAGGGTTTTTTTCTTGTAAGGCACGGCTTTCG
AAAATGATGACATGAGACTCTGCTGGGTAGCTGCGCTGGT
TTACTAACACTTGTTTAGGTGGGCCTGTATAAATTGCTCT
TTGATGGACTGGTCAGAGGGGAGATGAAAAAAAATCACAT
TTTCGATCACCTCAAACTGCGTTCTGCTCAAATTCTCGGT
GCAGGCGTCCAGGCTCATGCTAAAAACCTTGGGGTTCATG
CCAGAACATTTGAGGAGCTGGTTGAAACTTTGCTTATAAC
AGTGTCATGCTCTGATCTTCCATGTATTGACCTGCTTCAG
ATTGAATACTTTCATCAAGGCTCTAATGGGCCCATTGGGA
CAAGAGTGGCTCCTTTTGATGAAGCCCAAATACGGGGAGA
GCTTCAGGCTTATTTGTCCTACTGGACGGGACAGAGAGAA
CCTAAAGGGGTGGATATAGAGGAGGCCTGGAAATGCAGAT
CATGCCTGTATGAGGAGATCTGCGAATGGAGGAAGAACAG
ATTTACAGTTTCTGACCAACAAGCGGCTCATTCTAGCTCA
CACTTATGATTTTACAGATCATATTTATATATTTGAATGT
GCAGTGTTAATTATGCTTTTGACTTTTATACCTTGATTAA
TGTTTTCTTGTTCTATTGAAGCATTTCTGTTTTTAAATCA
GGATGTGAACATTATTGTGCAGCTCTATAATAACTGTGAT
TGAAGTGCTTTGACTGAATAATGCACTATTAAAGCCATGA
TGCATTTTTTTTTTTGTTTAGTATGGTATGGTTTAGTATG
TTTTATGGAAGCAGGCTTCTCTTGTTGTGTGCATTAAAAG
TTTTAGGCCACTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations