ZFIN ID: ZDB-TSCRIPT-090929-12181
Transcript Name: cbl-201
Previous Name: cbl-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029801 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029801|OTTDARG00000022950|ZDB-GENE-041114-207 cbl|OTTDARP00000024316 cbl-001 LG_ BX571886.9 Danio rerio protein_coding KNOWN, 4069 bp
CGCACAGATAGAGAAAGAGAGCTGCAGGAAAAGGGAACAT
CACGCACGGGGTGTCGATGTGAAAGCAGTTGTTCTACCAC
GTCCAGACACCCATCAAAACTTATTTTTACGCGTTATTTT
TAAACGGGTTCCGCCGCCCTCCCCGAGCGTTTTTAAACAC
AGCGTCAAACGGCGGTTTGCTGCACGGGGGATTTAATGGG
AGTCTTGCATCGGTAAAGCGCTTCTCCCCCCCTTGACGGA
CCCTCGCTCGAACCGAACCGGACTCGGGCGCTGTCCTCAC
CGGGGGGTATCCGATCCCAGTTATATTTTGACTGCGAAAA
CAACACTCCGGAGTCCGAATATGGCAGGAAATCTGAAGAA
AGGTGGGGGGCTTATTGGCATGATGAAGGACGCTTTTCAG
CCTCACCATCACCTCCACCACTCCCATCACCAGCCCGGAG
CCGTGGACAAAAAGACGGTGGAGAAATGCTGGAAATTCAT
GGATAAGGTGGTACGGTTATGCCAGAACCCCAAATTGGCC
TTGAAGAACAGTCCTCCGTACATCCTAGACTTGCTGCCAG
ATACATACCAGCATCTCCGCACTATCCTGTCTCGATATGA
AGGCAAGATGGAAACGCTAGGCGACAACGAGTACTTCCGT
GTTTTTATGGAGAACTTGACCAAGAAGACCAAACAGACCA
TAAGCCTGTTCAAAGATGGCAAAGAGCGAATGTTCGAGGA
GAACTCTCAGCCCAGACGGAACTTAACAAAGTTGTCGCTG
ATTTTCAGTCACATGCTCGCTGAGCTCAAAGCCATCTTTC
CTAATGGTCTGTTTCAAGGGGACAACTTCAGAATCACCAA
AGCGGATGCCGCAGAGTTCTGGAGAAGATCGTTCGGGGAC
AAGACCATTGTGCCTTGGAAGGTGTTCCGTCAGGCCCTGC
ATGAGTTTCACCCCATCAGCTCAGGCCTGGAGGCCATGGC
ACTGAAATCCACCATCGACCTCACATGCAACGACTACATC
TCCGTTTTTGAGTTTGACATCTTCACCAGGCTATTCCAGC
CATGGTCGTCATTGTTGAGAAACTGGAACAGCCTGGCAGT
GACTCATCCCGGGTACATGGCTTTTCTAACCTATGATGAA
GTCAAAGCTCGTCTACAAAAATTCATCCACAAGCCTGGCA
GCTATATCTTCAGACTGAGCTGTACGAGGCTCGGACAGTG
GGCTATCGGTTACGTCACGGCTGATGGAAACATCTTGCAG
ACCATTCCTCATAACAAACCCCTCTTCCAGGCCCTCATCG
ATGGCTTTAGAGAAGGATTCTACCTTTTTCCAGATGGACG
CACTCAAAACCCAGACCTCACAGGACTGTGTGAACCCTCA
CCTCAAGACCATATCAAAGTCACACAGGAGCAATATGAGC
TGTACTGTGAGATGGGCTCTACCTTCCAGCTGTGTAAGAT
TTGTGCTGAGAATGACAAGGATGTGAAGATCGAGCCCTGC
GGACACCTCATGTGCACTTCCTGTCTTACAGCCTGGCAGG
AGTCAGAAGGCCAAGGCTGCCCATTCTGTCGCTGTGAAAT
TAAGGGTACAGAGCCCATCGTCGTTGACCCCTTTGATCCT
AAGGATCCCAACAGCGCTGCCTCCTATGGCTGCAGGGGCA
TGTTTGGGGCTGAGGGAGCCCCTTCACCCAGCTACGACGA
TGATGATGATGACCGTTTAGAGGAAACTCCTTTCATGATT
AGCAAGCTGGTCGGCTCTAAAGTGGAGAGGCCGCCCTCGC
CGATGTCAATCTCCCCTCAGCCCGTCGTTCCTCCAGTACC
TCCTCGGCTGGATCTGCTTCCTCTCAGGCCCACCAACCCT
CCTGGGGCCTCAAGTCCAGGGGCCACATCCAAGGCCCCTT
CCCATCACAAAGACAAGCCATTACCGCTGCCGCCGGCTCT
AAGGGATCTGCCACCTCCACCTCCCCCAGACCGTCCACAC
CCAGCTGGAGCAGACAACCGTCTCCCAAGACGTCCTCTCC
CCAGTACGCCTGGAGACCCATCTCGTGACAAACTGCCCCC
GGCCCCTCCTAACCGCAACATGCCAGACTGGAACTCCCGG
CCTGTACCCAAAGCCCCATCACAGCCACCAGCAAGCGGAG
ACACCCGTGGATCTCGAGAGCTTTCCAACAGGCACTCTCT
GCCTCTCCAACTGCCCTCTACTCTCGATTCCAGAACAGAA
GCCCCCAGAAACAACGGCCCTCCCAGCCTCGACCACCAGC
TGAGTTTTGGATCATCGAATCCTGCATCGGATTATGACAG
TCCAAAAGTAAAGCCGTCTGCCTCGGCTAATGCCATCTAT
TCCTTGGCAATACGGCCTGTTGCAGCAGCAAGAACACAGA
CAGGGGAGGAAACCAATGAGAATGACGAGGAGTCCGAGTA
CATGACTCCATCTTCTCGACCAGTGCTGCCCTCTGCTGCA
GGGGAGGCTGTGCCCAGACCACCTCCACCACTCTCACTCA
GTCCCAGAAGTATGCTCAATGAATTAGAGTCAGAAAGTCC
ACAGATGTATGAAGCCATGTACAACATCCAAGCACAGGCC
CTCACAGCTTCTGCACCACAGGCCAGAGACTCGGATTACT
CCGAATTGCCTCCTTTGACCTGCTCTAATGGCCCGCGGGA
TCCTGTCGGTGCATATGCTGAGGAGGAGGAGGAGGAGGAG
AACAGCTATGACTATCCCAAACCTCATCTATCTGCAGCTC
TAGCCCGACGCACGCTTTCAGATGCTAACTCACCATCCTC
CTCAGCCTTCAGCCGCCTCTCCTTTGACAGTGACCTTGGA
GCAGCTGCAACTGTCCTGGACCCCTCTGAAGCCCCCGAGC
GGCCTCCTAAGCCATTGCCCCGTCGCATCAACTCGGATCG
CAGACCCAGTCCAGTTCCCCCCGGGGCGAGTCCAGGCCCC
AGCCAGCAGATCAGCAGTGAGATCGAGCACCTCTTGAGCC
AGGGATACTCCCATCAGGACATCCAAAAAGCCCTAATGAT
TGCACAGAACAATATTGAAATGGCCAAGAACATCCTGAGG
GAGTTTGTGTCCATCCCTTCTACTGCACATATCTTAACAT
AACGAAACTTCTCAGTGCACCCAGTCGCAGCCCGGCCACG
CTCGCCTCGTATTCGTCTTGGACTTCAGAAGTCAGTGGCG
TGACCCTGCATTCTTGCTCTAGCGATGGCAAGAGCCTGTT
TCTCCGTAACGCTTCTTGGATTCTCTGTCCTCCTTCGTGC
GCAAGGAACAGCAAGGGTTTTTTTGCGGCCGCTTCTTCAG
CCTGAAGCCAACGCATGTCCCTTGAGGCTAAACAAAGACA
AAAAAAAAAGACAAAAACATGTATGTGTTTATATATGGTT
TAATATATAAATCAGAATATTGAGTATAGTTAATATATAC
ACATGTATGTTGGAGAGGCACAGGGTTACCTGCAGACATC
AGGGTGTGTGAAGTATTAGGCCTCAGAGTTGGGATAGCTA
AAGGGAGTTCAGTAAACAGCAGACTGCAGCATTTTCTGGC
GTGAAAAATGGCCTTTACTTGTGTTGCTTCGGTACATTTT
GTTATTGAGTGTGTGATTTTTCTTTTTTTTGGTCTGTCTA
GTTGCATGTCGGTCCCCTCAGCGCAGTTACCAGTTTTAGA
AATACCGCTCAGCCCAAAGTGACCCGTTCTCCGATTGACC
TTGACCTCCAGGGTACTGTGGGATCTTTATTTCTTTTAAA
AGCGTGGTGGCTGGCTGGCATCGAAATTGGGCTCTCCGTC
AGCCTTGTTACATCTTTGTAGCATTACTGTAAGTGTACTG
TACCATGAAATTCACTTCCCAAATGTTTTAGGACAGCCAG
TCCTTCAAAGTTTCCAATTGGAATGCGCTGATGAAGGGTA
CACGCATCTGATGTCAGGGGACACGTAACCTGTTTGCTCT
AATCTGAATGTGTCATTAATATGATGGTCTCCGACAGACT
TTTGTGAAGTAGCGTGTTTACTAAAGATAGTGTTCTCTAA
CAGATTAAGGTGCGAGAGGTTGGAGACAAAGTGAAACTGC
TTAGTACAACAACAAAACACAAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cbl-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029801 (1),  Ensembl_Trans:ENSDART00000006085 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC085671 (1) 4023 nt
GenBank:EB933866 (1) 538 nt
CITATIONS (2)