header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12131
Transcript Name: med6-201
Previous Name: med6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029751 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029751|OTTDARG00000022919|ZDB-GENE-040625-61 med6|OTTDARP00000024275 CH211-259K16.1-001 LG_ CR354599.10 Danio rerio protein_coding KNOWN, 1154 bp
ACTGTCGACGTTGAATAGGCGTCATCATTCTGCGCCTTTC
TGCCAAGATGGCGACGGTGGATTTAAGAGATAATCTGCTG
GGCATCTCATGGGTGGACAGCGGCTGGGTGCCTATCCTGA
ACCCCAGCAATGTCTTGGAGTATTTCTCCGAGAGGAGCAA
TCCCTTCTATGATCGCACCTGCAACAACGAGGTGGTCAAA
ATGCAGAGATCAACCCTGGATCACCTCACTCAGCTGGTGG
GTGTGGAATATATTTTGCTTCACACTCAGGAGCCTATTCT
GTACATCATCCGAAAGCAGCAGAGACAATCACCAACACAA
GTGATCCCTCTTGCTGACTACTATATCATAGCTGGCGTGG
TGTATCAGGCTCCTGACCTGGGATCTGTAATCAGTTCCAG
AGCGCTTTCAGCGGTTCACGGGATTCAGTCTGCGTTTGAT
GAAGCCATGTCCTTCTGCAGATACCACCCGTCCAAAGGGT
ACTGGTGGCATTTTAAAGACCAGGAAGAGAAAGAAAGAGT
AAAGCCGAAATCGAAGCGGAAAGAGGAGCCGAGCTCTTTG
TTCCAGAGGCAGAGAGTCGACACGCTGTTACTGGACCTGC
GCAATAAATTTCCCCCAACCTTCTATCAGACCAAGCCAGG
AGAGAAGCCTGTTCCAGTGGAGGTTAAAAAAGAGCCAGAA
GTGCCTGTTGAGACGGTGAAGCCTCAAGAAGAGCGAGAGA
CGAAACCTCCAGCTCCTCCTGCACCTCCACGGCCTCCACC
ACAAACTACACCCAACAAACCTCCACCTGAGAAGCGTGCT
CGTGTACAGTAACAAACACCTGCAGCCACAAAACATCAAT
GCTAAGGGACTGACTGATGTTCAGACCTGTGGACCGTTCT
CTGCAGCAGCTCACTGAGGGTGGACTGTTACGGTTATTGT
ACATACAGGACTTTCTTCAAGACTTTTCTTCTTTACTTCA
ATTGTTTTTGTAGTTAGGAAACTGAAATATGTTTCATATC
TGTATGGCCTTTTCTGTATTTCAGTGTTTCTGGGTTGTAG
TATTATGCCATTGTATTAATCGGAGTGAAAAGTCATTTTT
CACATCTTGTTTGCAGTGTTTGTCATAATGCATATAGTCT
ACAGACTTTTCTGATGATTAAAAGAGTATTTGTA

med6 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript med6-202 (1)    Ensembl 859
mRNA med6-201 1154
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
med6-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029751 (1),  Ensembl_Trans:ENSDART00000044115 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC071547 (1) 1470 bp
GenBank:EH543237 (1) 897 bp
GenBank:EH565587 (1) 823 bp
CITATIONS (2)