Transcript

phf3-203

ID
ZDB-TSCRIPT-090929-12122
Name
phf3-203
Previous Names
  • phf3-003
  • si:dkey-188i13.1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029742 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029742|OTTDARG00000022913|ZDB-GENE-090313-207 phf3|OTTDARP00000024268 DKEY-188I13.1-003 LG_ BX005106.5 Danio rerio protein_coding NOVEL, 425 bp
GGGCACACCGCCCTCTGCCGACAGACATTGCACGTCACGA
GTTGTTTGCTGGCTCATAGGGTCAACAGGAAGTACTACTT
GTGTCCCACCGCAGTTCTCGGCGGAAAAGGCAGTGGCAAC
TTGACGACAACGGCAACCCATATGGCGTCCAGACACCATG
CCGATCATGAAATGACAGGAGCAGGTGTTAGGCAGAGTCC
ATCCGATGGAGAACACAATCAATCTGGCTTCTTGCAAGAC
AGGAGACAAGCAGGTCAAATGCAGAGGAGGCAAACAGCAA
GCCGTGGTCGAGTCAGAGGCAGGCGCCTAGGTCCTGCACG
AAAAGCAGCTGAAAGTTACAACCGAGAGTCAACATGTAGT
GAAGAACATGATAGAGATAACAGCCCTGATGAAAAAAGGG
AAGCCCTGCTTAGCCGTCGATTTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations