header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12046
Transcript Name: ctsh-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029663 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029663|OTTDARG00000022876|ZDB-GENE-030131-3539 ctsh|no_translation CH211-234P18.1-002 LG_ CR450750.18 Danio rerio protein_coding KNOWN, 543 bp
CAACCTTTTAATCTTGTCACATGCTTTTTAGAGGACTCCC
GAGTCATGCCTTTGAGTATATCATGTACAACAAAGGTCTT
ATGACAGAAGATGATTATCCCTACCAGGCTAAAGGGGGTC
AATGTAGATTCAAACCACAATTGGCTGCAGCTTTTGTGAA
GGAAGTTGTAAACATCACAAAGTATGATGAAATGAGCATG
GTGGATGCAGTTGCCAGGTTGAACCCTGTCAGCTTCGCAT
ATGAGGTGACATCTGATTTCATGCACTACAAGGATGGAAT
TTATACCAGCACTGAGTGTCACAACACTACTGACATGGTA
AACCATGCTGTGCTCGCTGTGGGTTATGCTGAGGAGAATG
GAACGCCATACTGGATCGTGAAGAACTCCTGGGGAACCAA
CTGGGGGATTAAAGGGTCTGTTTAAATTTTTTTTAAATAT
CGTGCTATGCTATAAGGTAAGAATGGTTGGTTTTAAAGGT
GCTGCATGTAAGTTTTTGACTCTTTTAAAGCATAAATTTA
CCATAATGTTTGCAGATATTTAA

ctsh TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ctsh-002 543
mRNA ctsh-201 (1) 1374
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctsh-002 Contained in:

OTHER ctsh-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029663 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB951642 (1) 543 bp
    CITATIONS (1)