Transcript

ctsh-002

ID
ZDB-TSCRIPT-090929-12046
Name
ctsh-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029663 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029663|OTTDARG00000022876|ZDB-GENE-030131-3539 ctsh|no_translation CH211-234P18.1-002 LG_ CR450750.18 Danio rerio protein_coding KNOWN, 543 bp
CAACCTTTTAATCTTGTCACATGCTTTTTAGAGGACTCCC
GAGTCATGCCTTTGAGTATATCATGTACAACAAAGGTCTT
ATGACAGAAGATGATTATCCCTACCAGGCTAAAGGGGGTC
AATGTAGATTCAAACCACAATTGGCTGCAGCTTTTGTGAA
GGAAGTTGTAAACATCACAAAGTATGATGAAATGAGCATG
GTGGATGCAGTTGCCAGGTTGAACCCTGTCAGCTTCGCAT
ATGAGGTGACATCTGATTTCATGCACTACAAGGATGGAAT
TTATACCAGCACTGAGTGTCACAACACTACTGACATGGTA
AACCATGCTGTGCTCGCTGTGGGTTATGCTGAGGAGAATG
GAACGCCATACTGGATCGTGAAGAACTCCTGGGGAACCAA
CTGGGGGATTAAAGGGTCTGTTTAAATTTTTTTTAAATAT
CGTGCTATGCTATAAGGTAAGAATGGTTGGTTTTAAAGGT
GCTGCATGTAAGTTTTTGACTCTTTTAAAGCATAAATTTA
CCATAATGTTTGCAGATATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations