header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12045
Transcript Name: ctsh-201
Previous Name: ctsh-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029662 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029662|OTTDARG00000022876|ZDB-GENE-030131-3539 ctsh|OTTDARP00000024208 CH211-234P18.1-001 LG_ CR450750.18 Danio rerio protein_coding KNOWN, 1374 bp
GAAAGAAGGAGGAGTTGGGGCTCATGTGAGCACATCTCGC
TACTGTACCGGTGTTATTGTTCACAGGACAGGAGAGAAGA
TGAACAGGCTGATTTTAGCGGTCCTGTTCGCGGTTCTCTA
TCAGGTACTTGCAGTTCCGTTGTACACCGAGGAAGATGAG
TATCATTTCAAATCATGGATGTCTCAGTACAATAAAAAAT
ATGAGATAAATGAATTTTACCAGCGGCTGCAGATATTCCT
GGAGAACAAGAAGAGGATTGACCAACATAATGAAGGAAAC
CACAAGTTTTCAATGGGACTGAACCAGTTTTCAGACATGA
CCTTTGCTGAATTTAAAAAGACTTACCTCCTGACGGAACC
CCAGAACTGTTCAGCCACTAGAGGGAATCATGTGAGCAGT
AATGGGCTTTACCCTGATGCTATCGACTGGAGAACCAAGG
GACACTACATTACTGATGTCAAGAATCAGGGACCCTGCGG
GAGCTGCTGGACTTTTTCCACCACAGGCTGTCTGGAGTCT
GTCACTGCTATCGCCACAGGGAAACTCCTGCAACTAGCAG
AGCAGCAGCTTATAGATTGTGCAGGTGATTTCGACAATCA
TGGTTGCAACGGAGGACTCCCGAGTCATGCCTTTGAGTAT
ATCATGTACAACAAAGGTCTTATGACAGAAGATGATTATC
CCTACCAGGCTAAAGGGGGTCAATGTAGATTCAAACCACA
ATTGGCTGCAGCTTTTGTGAAGGAAGTTGTAAACATCACA
AAGTATGATGAAATGAGCATGGTGGATGCAGTTGCCAGGT
TGAACCCTGTCAGCTTCGCATATGAGGTGACATCTGATTT
CATGCACTACAAGGATGGAATTTATACCAGCACTGAGTGT
CACAACACTACTGACATGGTAAACCATGCTGTGCTCGCTG
TGGGTTATGCTGAGGAGAATGGAACGCCATACTGGATCGT
GAAGAACTCCTGGGGAACCAACTGGGGGATTAAAGGATAT
TTCTACATTGAAAGAGGAAAGAACATGTGTGGACTTGCTG
CGTGTTCATCCTATCCTATACCTTTGGTGTAAACAAAAGA
AACGCATGAAAAGGGAGACTTTTTGTTTTTACATATTTCT
ACTCTCACACAAAATCATTTTATGCACAATAGTGTCAGTG
ATGAGCCATTATAGTCAATACTAGTTTTCATGAAATCAGA
TAAACACTTATTTTATTTTTATATGTGCATTGATTTAAAA
CATACAGTAACGCACACTCGATTAGCCTCCAATGTAGTCA
CTGTTGAAGGAGTTTACTTTGTTAACATTCAGATTTTGTG
TTTTTGATGTTTGCATCAAAAAGTATTGTACTGAAATAAA
TATTTTCTCAGGGA

ctsh TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ctsh-002 (1) 543
mRNA ctsh-201 1374
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctsh-201 Contained in:
OTHER ctsh-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029662 (1)
  • Ensembl_Trans:ENSDART00000060245 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067615 (1) 1331bp
    GenBank:EH441648 (1) 855bp
    GenBank:EH514866 (1) 396bp
    CITATIONS (2)