Transcript

pdlim1-201

ID
ZDB-TSCRIPT-090929-12026
Name
pdlim1-201
Previous Names
  • pdlim1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029643 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029643|OTTDARG00000022864|ZDB-GENE-030131-5227 pdlim1|OTTDARP00000024193 pdlim1-001 LG_ BX663512.4 Danio rerio protein_coding KNOWN, 1724 bp
GAATTCGACTGGATTTGGGAGTGGCACATACCAAATCCTA
GGATTTGGCTCTTCCATACATGGTAAACTTAAATATGAGA
TGACGTAACGGTCCACCCCTAAACAAACATAGGAAATAAA
CTCTTATCAGCACAGAGACCTGACATTATTCGCTCCCTTT
AGAGGAAGCTCCGCCCAGGTATCATTTCTTCAAAGTGAAC
GCCCCTGTCCTGCGACAGAAACTGCCCAGTTCTACAGTTT
ACGGTGCACTGCTCCAGGATTAAGTTTGCCTGTTGGAACT
ATAATGCCTCAGCGGGTTGTTTTACAAGGTCCCGGGCCAT
GGGGATTCCGTCTGGTCGGGGGTAAAGATTTCGAGCAGCC
TCTGACTATCTCGAGGGTAACCCCAGGAAGTAAAGCAGCT
CAGGCTGACCTCTGCATGGGGGACATGATCCTGGCCATAG
ATGGAGAGTCCACTGATGGCATGACCCATCTGGAGGCACA
GAATAAAATCAAAGCCTGCGGGGATGAAATGGCACTTTCC
ATTGACAGATCAGAATCAAAAATGTGGTCGCCTCTAGTCA
CTGAAGACGGAAAGACGAATCCATACAAGATGAATCTGGC
AAAAACCAACACACAGGAGGAGAAGCATATAGGCTCTGCT
CATAACAGAAGTGCTATGCCATTTAATTCTGCCAGTCCTA
GAGTCGTCACCAACCAGTACAACAACCCGGCTGGCCTGTA
CTCCTCTGAAAACATCAAGAACTTCAACAGCGCAGTGGAT
GAAGTCCAGACGACCGCTGCCTCCAGTGAAGCTAGCAGGA
ACTCAGATCCCAGTAAACCAGGCCACACAAAAGCTGCTAT
AGCTGCAGATTCAGAGGTGTACAAAATGCTGCAGGAGAAT
CAGGAATCCAATGAACCTCCTCGCCAGTCGGCCTCTTTTA
AAGTTCTGCAGGAGATCCTGGAAACTGGTGATTCAGAGAA
ACCCTCAGGCTTCAGAAGCGTCAAGGCTCCTACCACAAAA
ATTGGAGCTTCCGTTGGGAATCCTGAAAAGCTCTCTCTTT
GTGACAAATGTGGATCAGGGATTGTAGGAATGATTGTCAA
ACTTCGAGATAAGTTTCGTCACCCAGAATGCTACGTCTGC
ACAGACTGCGGGATCAATCTGAAGCAAAAAGGACACTTTT
TTGTTGAGGACCAGATTTACTGCGAGAAGCACGCACGCGA
ACGCATCACTCCTCCAGAGGGTTATGATGTTGTCACCGTT
TTTCCAAAATAGAGCATTTCCCCTGTGCCGCTTTACAACT
GCACATTCCCTTATGAGGGAAATTCGTAACACTTAATTTG
GATAGTATTCCAGTGAGGCTGCTCTGTTGCTAGCAAGGGT
AGCGCATGGATTTAAAAGGACTTTGGCAACAATGATCATG
AAATGTGAATACAGAGTCTGTCCACATAAAGTGCTGTCGT
TGTCTTACATTCCATTTTCTTAATCATTCCATTCATGTAT
CGCATAAAAGGCTCAATTAACGGTGCTTGGGTATCTTCAG
GCCGCTTATTGCATTTTCATTTTTCCGTAAAACGTTTTTT
ATGAATTGATCATTGAAATGTATGTAATCATGGTCATATT
CCTCTCGCACAGTGATATGTAAAACTATTCAATGTATGTA
TGGTCTTTTGGAATCTCCATATTTTTTTATAAAAAGAATG
AATTTGTATTTGCTATAAAAAATAAAATGTTTCATATCCA
TTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations