ZFIN ID: ZDB-TSCRIPT-090929-12024
Transcript Name: spef1-202
Previous Name: zgc:66426-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029641 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029641|OTTDARG00000022863|ZDB-GENE-040426-1639 zgc:66426|OTTDARP00000024191 CH211-223P8.1-001 LG_none AL831745.3,AL929005.7 Danio rerio protein_coding KNOWN, 1678 bp
CAAGTGAGCGAAATGACCTCTACGGCACCCTGTATTTTGT
TGCCTAGTAACAGGTCAAACATTTTAATGATACACCTGAA
ATAATAGTTGGTTTTGATTACTCAAAGGCTCGTTTTAAAT
TATGGACGGGCCAAAACAATTAGACGAAGAAACCTTGCAA
GACCTTTATGCGTGGATAGACAAGATACCGCTCTCCAGAC
CCAAACGCAACATAACACGAGATTTTAGCGATGGAGTTAT
GGCTGCTGAAGTGGTGAAGCATTTCTTCCCTAAGCTGGTG
GAGCTGCACAACTACACGCCCGCACATTCCACGCAGCAGA
AGCAGAGTAACTGGATCACCCTCAACAGAAAAGTTTTCTC
CAAGCTAAACTTCCATATACCTGAGGACACGGTGAAAAAA
ATTGTAGTGAGCACACCAGGCTACATTGAACCAGCCCTTT
GCTCTTTGAGAGAGAAGATCGAGGAAAAGAAAGAAGGAAA
ACAACCAGATAGCGCACAGGACTTGGAGTATTACACCACT
TCAGATGGACAGCAGGGATCAGGGAATCATGTGATGGTTA
TTGAACCCAGTCATTTAAATCCAGCTACTGTGAAGAAAAC
AGAGAAAGTCAGGGCTGCTGGAACCATTGGACCAAATGTG
GATCCAGCTGTACGTTTGCTTTTGGAGGAAAAGGAGCAGG
CCATTTTGGCTTTACAGGAGACTGTTGGTATTTTACAGAT
TAAAGTAAACCGATTGGAGCACCTTGTGCATCTTAAGGAC
CTACGCATTGAGGATCTCACAAAGCACTTAGAGCGATATA
AAGCACGCAACTCATGAACATCATTTCAAAAAGTGCATAG
GAATACGTAAGACTTACAAAAAGCTGGCCCATGATCCATA
TGAAATCATCTCTTTTTCCTCATTTGTTTTATGCTCTGTG
ATTGTTAGATTTTTTCTTTTAATTGTTGGCACACCAATTG
CATTACCAAGGACCATCTAGAGCAGTTTATGCTTCACTGT
GAAGTCCAACAAACTTTGGCAGTAAAGTTTTTATTCCTTG
ATGCATTTCAGACATTCTGGAAATGATTCACCAGTATTAG
TACTTGCTTTTTATTTTGGAATTTAAATGATATTTCTAAG
TGTTTTTTTTTTCTTTCTTTCTTTCCCCATGCATTTATAA
ATTGATTTCAATCACTGTTAAACTTTATAAATCTTTAAGC
AAAGCTTGCTCTCCAAATGAATGACTAAGTGTTGTAATTG
CTCTGTGTTTTCCCTAAATTTTATTTTGGCATTTGTGTTA
ATGATACATTCATTTTTATGTTTCCATTCATGTTGATATT
CTCAAATTTAGCTTTACTCTATTTTGGGATTTGCTGATCA
TTGTACATTTTTGTATGTCACAGTATTATTAGCTGTCATG
TCATAAGACCAGTCTGTAATTTTTGTGGACAGCGTTAGAT
GTTGAAAGTAAAGATTTGCATTCAAATGGATTTGGTTCCT
ATGCAAGCATGGAGAAAAGTTGCAGAGGTTTTTAAGCAGA
TGGTTAACAAATAGTTATGGTTGTTTGTTTGCATGGACAC
ATGCTGTCACTTACAGAAAGCAGAGTTAATTTTGACTAAA
TTTCACTTCTTCTTTCTTTAAGACCAAAATATCCTATTCC
TACTGATGCTGACCTATAAAACTAAAGATGTAAAATTA

spef1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA spef1-201 (1)    Ensembl 771
spef1-202 1678
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spef1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029641 (1),  Ensembl_Trans:ENSDART00000033090 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC055652 (1) 1590 nt
GenBank:EH548639 (1) 497 nt
CITATIONS (2)