Transcript

slc18b1-202

ID
ZDB-TSCRIPT-090929-11901
Name
slc18b1-202
Previous Names
  • slc18b1-002
  • zgc:110176-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029511 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029511|OTTDARG00000022791|ZDB-GENE-050417-386 slc18b1|OTTDARP00000024090 CH211-195G8.1-002 LG_ CR407704.10 Danio rerio protein_coding KNOWN, 660 bp
TGAACACGCGGTAGGAGTTTACACGGCGACAATGGAAAAT
CATGAAGACAGAGGTGATTCTTCGCCATCACAGACTACAG
GCGCTAAAATGTCCAGACAACAAATACTGACAGTTATTGC
AATGGCCTCCATAAACTTCGGTTCAATGATTTGCTATTCC
ATTCTGGGACCATTTTTCCCAAATGAGGCAAAGAAGAAAG
GTGTCAGTCAAGCTATGATTGGTTTAATATTCGGCATTTA
TGCATTATGCACTTTGGTGGGCTCTTTGATACTTGGTAAA
TATATTGTCCAGATAGGAGCCAAGTTTATGATTGTGGCAG
GGCTTTTCTTGTCGAGTGGGTGTACTGTACTCTTCGGGTT
TCTTGACAGAGTGTCTGACGGGACAGTATTCATTGCTCTC
TGTTTTATCACACGCTCCATCAATGCAGTTGGATTTTCCG
CCGCCATTACATCATCTTTTGCTGTTTCAGCAAAGATTTT
CCCCGACAACATAGCAACTGTTTTGGGCTTTATGGAGATT
TTTACAGGACTTGGCCTGATTCTGGGGCCTCCATTGGGTG
GTTGGCTGTATCAGGCGTTCGGATATGAAATCCCATTCGT
TTTCACAGGATGTCTTCTGTTTGCCACAGTTCCTCTAAAT
ATGTGGATTTTGCCAAGCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations