header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11901
Transcript Name: slc18b1-202
Previous Names: slc18b1-002, zgc:110176-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029511 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029511|OTTDARG00000022791|ZDB-GENE-050417-386 slc18b1|OTTDARP00000024090 CH211-195G8.1-002 LG_ CR407704.10 Danio rerio protein_coding KNOWN, 660 bp
TGAACACGCGGTAGGAGTTTACACGGCGACAATGGAAAAT
CATGAAGACAGAGGTGATTCTTCGCCATCACAGACTACAG
GCGCTAAAATGTCCAGACAACAAATACTGACAGTTATTGC
AATGGCCTCCATAAACTTCGGTTCAATGATTTGCTATTCC
ATTCTGGGACCATTTTTCCCAAATGAGGCAAAGAAGAAAG
GTGTCAGTCAAGCTATGATTGGTTTAATATTCGGCATTTA
TGCATTATGCACTTTGGTGGGCTCTTTGATACTTGGTAAA
TATATTGTCCAGATAGGAGCCAAGTTTATGATTGTGGCAG
GGCTTTTCTTGTCGAGTGGGTGTACTGTACTCTTCGGGTT
TCTTGACAGAGTGTCTGACGGGACAGTATTCATTGCTCTC
TGTTTTATCACACGCTCCATCAATGCAGTTGGATTTTCCG
CCGCCATTACATCATCTTTTGCTGTTTCAGCAAAGATTTT
CCCCGACAACATAGCAACTGTTTTGGGCTTTATGGAGATT
TTTACAGGACTTGGCCTGATTCTGGGGCCTCCATTGGGTG
GTTGGCTGTATCAGGCGTTCGGATATGAAATCCCATTCGT
TTTCACAGGATGTCTTCTGTTTGCCACAGTTCCTCTAAAT
ATGTGGATTTTGCCAAGCTT

slc18b1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc18b1-201 (1)    Ensembl 1481
slc18b1-202 660
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc18b1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029511 (1),  Ensembl_Trans:ENSDART00000133301 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DN601407 (1) 863 bp
GenBank:CB354914 (1) 403 bp
CITATIONS (2)