header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11900
Transcript Name: slc18b1-201
Previous Names: slc18b1-001, zgc:110176-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029510 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029510|OTTDARG00000022791|ZDB-GENE-050417-386 slc18b1|OTTDARP00000024089 CH211-195G8.1-001 LG_ CR407704.10 Danio rerio protein_coding KNOWN, 1481 bp
ACACTGTTTACTGATCAACGAATGTATGTGAACTTCATGT
AGGTGATTCTTCGCCATCACAGACTACAGGCGCTAAAATG
TCCAGACAACAAATACTGACAGTTATTGCAATGGCCTCCA
TAAACTTCGGTTCAATGATTTGCTATTCCATTCTGGGACC
ATTTTTCCCAAATGAGGCAAAGAAGAAAGGTGTCAGTCAA
GCTATGATTGGTTTAATATTCGGCATTTATGCATTATGCA
CTTTGGTGGGCTCTTTGATACTTGGTAAATATATTGTCCA
GATAGGAGCCAAGTTTATGATTGTGGCAGGGCTTTTCTTG
TCGAGTGGGTGTACTGTACTCTTCGGGTTTCTTGACAGAG
TGTCTGACGGGACAGTATTCATTGCTCTCTGTTTTATCAC
ACGCTCCATCAATGCAGTTGGATTTTCCGCCGCCATTACA
TCATCTTTTGCTGTTTCAGCAAAGATTTTCCCCGACAACA
TAGCAACTGTTTTGGGCTTTATGGAGATTTTTACAGGACT
TGGCCTGATTCTGGGGCCTCCATTGGGTGGTTGGCTGTAT
CAGGCGTTCGGATATGAAATCCCATTCGTTTTCACAGGAT
GTCTTCTGTTTGCCACAGTTCCTCTAAATATGTGGATTTT
GCCAAGCTTTGATGCTGTTCCTTCCCAGAATTCTTTCCTC
AGACTCTGTACCAGAATAAAGATCCTCCTCATCTGCTTTG
TGGTGTTCACAATGAGTTCAGGACTTGGGTTCCTGGATGC
AACTCTGTCTATATTTGCCATTGAAAAGCTGAAGCTCAGC
GCTGGTTCAGTGGGGCTCCTCATGATTGGACTCTCTCTGC
CGTACGGGGCGGCGTCACCTATCTTTGGTGTGATCAGTGA
TAAATATCCTTCATTTAGGAAGTGGATGATGGTGATTGGA
GGAATGGCCACAGCCGTGAGCTTCTGCTTCCTCGGCCCAC
TTCCTTTTTTCCATATAAGAAGTCAGCTCTGGCTCACCGT
CCTCATGCTGGTGATTGTGGGCTTTTCTCTGTGTATGACC
TGCATCCCCACTTTCGCTGAGATGATCGCTTGTGCACATG
AATATGGCTTTGAGGAGAGCTTGAGTACGCTTGGATTGGT
GTCAGGACTGTTTTCTGCAGTTTGGTCTGCTGGGATGTTT
TTCGGGCCGACTATTGGAGGATACATCACAGAAGCACTGA
ACTTTGAATGGAGTGCAGGGGTTCAAGGCGCACTCGCTTT
TCTTGCTGCTTTACTACAAGTAATATATTTCACAATAGAG
GACATACAAAAAAAGTCTAAAAACGCCAACCAGAATGAAA
TTTCAGGAGAAAAATCTCCTCTTCTCCCCAAGACAGATGA
TCTCAGAGCAGACATCAGCTGAAATAATCCAGCGCAAGCT
TTTAAACAGAAGAACACACTTCATCATATTGCTGCTAAAC
ACAGGTGATGTGGAAGATGACAAACATGAAGGTCAATTCA
A

slc18b1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc18b1-201 1481
slc18b1-202 (1)    Ensembl 660
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc18b1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029510 (1),  Ensembl_Trans:ENSDART00000064665 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC092773 (1) 1496 bp
CITATIONS (2)