Transcript

slc18b1-201

ID
ZDB-TSCRIPT-090929-11900
Name
slc18b1-201
Previous Names
  • slc18b1-001
  • zgc:110176-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029510 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029510|OTTDARG00000022791|ZDB-GENE-050417-386 slc18b1|OTTDARP00000024089 CH211-195G8.1-001 LG_ CR407704.10 Danio rerio protein_coding KNOWN, 1481 bp
ACACTGTTTACTGATCAACGAATGTATGTGAACTTCATGT
AGGTGATTCTTCGCCATCACAGACTACAGGCGCTAAAATG
TCCAGACAACAAATACTGACAGTTATTGCAATGGCCTCCA
TAAACTTCGGTTCAATGATTTGCTATTCCATTCTGGGACC
ATTTTTCCCAAATGAGGCAAAGAAGAAAGGTGTCAGTCAA
GCTATGATTGGTTTAATATTCGGCATTTATGCATTATGCA
CTTTGGTGGGCTCTTTGATACTTGGTAAATATATTGTCCA
GATAGGAGCCAAGTTTATGATTGTGGCAGGGCTTTTCTTG
TCGAGTGGGTGTACTGTACTCTTCGGGTTTCTTGACAGAG
TGTCTGACGGGACAGTATTCATTGCTCTCTGTTTTATCAC
ACGCTCCATCAATGCAGTTGGATTTTCCGCCGCCATTACA
TCATCTTTTGCTGTTTCAGCAAAGATTTTCCCCGACAACA
TAGCAACTGTTTTGGGCTTTATGGAGATTTTTACAGGACT
TGGCCTGATTCTGGGGCCTCCATTGGGTGGTTGGCTGTAT
CAGGCGTTCGGATATGAAATCCCATTCGTTTTCACAGGAT
GTCTTCTGTTTGCCACAGTTCCTCTAAATATGTGGATTTT
GCCAAGCTTTGATGCTGTTCCTTCCCAGAATTCTTTCCTC
AGACTCTGTACCAGAATAAAGATCCTCCTCATCTGCTTTG
TGGTGTTCACAATGAGTTCAGGACTTGGGTTCCTGGATGC
AACTCTGTCTATATTTGCCATTGAAAAGCTGAAGCTCAGC
GCTGGTTCAGTGGGGCTCCTCATGATTGGACTCTCTCTGC
CGTACGGGGCGGCGTCACCTATCTTTGGTGTGATCAGTGA
TAAATATCCTTCATTTAGGAAGTGGATGATGGTGATTGGA
GGAATGGCCACAGCCGTGAGCTTCTGCTTCCTCGGCCCAC
TTCCTTTTTTCCATATAAGAAGTCAGCTCTGGCTCACCGT
CCTCATGCTGGTGATTGTGGGCTTTTCTCTGTGTATGACC
TGCATCCCCACTTTCGCTGAGATGATCGCTTGTGCACATG
AATATGGCTTTGAGGAGAGCTTGAGTACGCTTGGATTGGT
GTCAGGACTGTTTTCTGCAGTTTGGTCTGCTGGGATGTTT
TTCGGGCCGACTATTGGAGGATACATCACAGAAGCACTGA
ACTTTGAATGGAGTGCAGGGGTTCAAGGCGCACTCGCTTT
TCTTGCTGCTTTACTACAAGTAATATATTTCACAATAGAG
GACATACAAAAAAAGTCTAAAAACGCCAACCAGAATGAAA
TTTCAGGAGAAAAATCTCCTCTTCTCCCCAAGACAGATGA
TCTCAGAGCAGACATCAGCTGAAATAATCCAGCGCAAGCT
TTTAAACAGAAGAACACACTTCATCATATTGCTGCTAAAC
ACAGGTGATGTGGAAGATGACAAACATGAAGGTCAATTCA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations