Transcript

actr2b-201

ID
ZDB-TSCRIPT-090929-11781
Name
actr2b-201
Previous Names
  • actr2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029386 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029386|OTTDARG00000022729|ZDB-GENE-050410-4 actr2b|OTTDARP00000023999 DKEY-66M17.2-001 LG_ BX629343.11 Danio rerio protein_coding KNOWN, 1343 bp
CCTGCGCTGCTGTTTGAGTGCTAGAAGCACTTTGTTGAGA
AAGTTCGGCTTCCTCTGACGGCTCCTCTGGGTCTCTGAAA
GATGGACAGCCAAGGAAGAAAAGTGGTGGTTTGTGATAAC
GGAACAGGGTTTGTGAAATGTGGCTACGCTGGGTCCAACT
TCCCAGAGCACATCTTCCCGGCACTGGTGGGCCGACCTAT
CATCCGATCCACAGCTAAAGTGGGCAACATTGAGATTAAG
GATCTGATGGTGGGAGATGAAGCAAGTGAACTGCGCTCAA
TGCTGGAGGTCAATTATCCAATGGAAAATGGAATCGTCAG
GAACTGGGATGACATGAAGCACTTATGGGATTACACTTTC
GGTCCGGAGAAGCTCAATATCAACTCGCGTGACTGCAAGA
TCCTCCTCACAGAGCCTCCAATGAACCCGACCAAGAACCG
CGAGAAGATCATAGAGGTCATGTTTGAGACATACCAGTTT
ACAGGCGTTTACATAGCCATCCAGGCTGTGCTAACACTCT
ATGCTCAAGGCCTTTTGACAGGGGTGGTGGTGGATTCGGG
CGATGGCGTCACACACATTTGTCCTGTGTACGAGGGCTTC
TCTTTGCCCCATCTTACGAGGAGGCTGGACATTGCGGGAC
GAGACATTACACGCTATCTCATTAAGTTGCTGTTGCTGCG
AGGTTACGCCTTTAACCATTCAGCAGACTTCGAGACGGTG
CGCATGATGAAGGAGAATCTCTGCTATGTGGGATACAACA
TCGAGCAGGAGCAGAAGCTCGCTCTGGAGACCACCGTATT
GGTGGAGTCCTACACGCTCCCTGATGGCCGGGTTATAAAG
GTGGGAGGTGAGAGGTTTGAAGCCCCAGAAGCTCTGTTCC
AGCCTCACCTCATAAATGTGGAAGGGGTCGGCGTGGCTGA
ACTTCTCTTCAACACCATTCAAGCGGCAGATATTGACACC
AGGGCTGAGTTCTACAAACACATCGTTCTGTCAGGAGGAT
CCACCATGTATCCTGGCCTGCCGTCTCGACTGGAGAGGGA
ACTTAAACAGCTTTATCTAGAGCGGGTACTGAAGGGTGAT
GTTGACAAGCTCTCAAAATTCAAGATCCGCATCGAAGACC
CTCCCCGCCGCAAGCACATGGTGTTTCTGGGCGGAGCAGT
TCTGGCCGACATCATGAAGGACAAGGACAACTTCTGGCTC
ACCCGGGAAGAGTATCAGGAGAAGGGTGTGCGGGTTCTGG
AGAAGCTGGGAGTCACCGTCAGATAGAACACCAGCTCATC
ACCAGTCGCTTTTGTTCAGCCTGTCAATCCTGTCATCAGT
GCTGTGTCCGGCAGAAAGCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations