ZFIN ID: ZDB-TSCRIPT-090929-11780
Transcript Name: spred2b-201
Previous Names: spred2-001, spred2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029385 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029385|OTTDARG00000022728|ZDB-GENE-040426-2342 spred2b|OTTDARP00000023998 DKEY-66M17.3-001 LG_ BX629343.11 Danio rerio protein_coding KNOWN, 3030 bp
AACATGGAGTAATCAGAGATGGGGCTCGTCGGGGCCACCT
CAGCTACAGCAACACTCCTTCCAGCTGCAGCGTTCTCGGA
AATACACACAAGCACTCAAACCGGGGGAAACGATCCGAAT
TAAGGCTCTTTATTCCGAGATACTCCTCCATCAGCAACTG
GTTAGGAAAAAAGGAGTGGAAAAAAAAGAAAAGAAGCGAA
AAAGCCATCAAGACGGAGACGAGGAGAGGAGAGGGAGCGA
CAAGAAGACAAACACACAGCCGAATGTGATGGATTATTTT
GGGGGAAAAGAGTCTGGAGTGAGGCGTGAAGATGACGAAC
AGACCGAGCGGACCCGCTGTGGGATTTATGTGTAGGTGAA
ACGAGAAAAATGATTGAAGAAACACACCCAAACGATGACA
GTTACATTGTGCGCGTCAAAGCGGTGGTCATGACCCGAGA
TGACTCCAGTGGTGGATGGCTGGCACAGGAAGGTGGGGGG
CTCAGCAGGGTGGGCGTCTGTAAGGTGATGCCTGCTGAGC
TGACCGGCCGCAGCGACTTCCTCATCCACGGCGAGCGGCT
CAAAGACAAGCAGGTGATTTTGGAATGTTTCGTGAGGAAA
GACCTGATCTACACCAAGGCCACGCCCACATTTCACCACT
GGAAGGTCGACAACAAAAAATGCGGCCTGACGTTCCAGAG
CCCCGCCGATGCTCGTGCCTTTGACAGAGGAGTGCGGAAA
GCCTTGGAGGACTTAACAGAGGGTTCCACAACTTCCTCTT
CAACACTCCAAAATGAGGCTGAACTTGGGGATGATGATGT
GTTCACAACTGCCACCGACAGCTCCTCAAACTCATCTCAG
AAGAAGGATCACAGCACTCAGCTTGTGGCCACCTCCACCT
TCTACGAGCCTCATCCGCACCGCTGCATCCTGCAGTACCG
GCCGCCTGAACGCTACACTCTGGATCAGAAGTTCTCTAGG
AACCTGTTCTCCTTCGAGGACGAGGAGATTGTCCGAATAA
ACCCCCGCGAGCGCTGGATGATCACAGGCTATGAGGACTA
CCGATACGCTGCCGTGCCGGACAAGTTCATCCAACCGCAG
GACTCAGACTCATATGTTCAAATCAGCAAGAACGATCCTG
TAAAGCACGACTACACCTACCCCTATGTGCCCAGCCCCGA
TTTTACTCAGTGTGACCTGAAGAGGCCCTGCGGTGGTGGG
AGCACTGTAGTGTCCACCCAGCCAAGGGCCTTCATCCTTA
AAGGCAAGCGGAGGAAAGAGGACGGTGAGCGATCGCGCTG
CGTCTACTGCCGGGACATGTTCAATCACGAGGAGAACCAA
CGCGGGCAGTGCCATGACGCTCCCGATCCCATCCGGACCT
GCATCCACCGGGTCAGCTTCATGTGGTGCGCCGACAGCAT
GCTTTACCACTGCATGTCCGACCCAGAGGGCGACTACTCG
GACCCATGCTCCTGCGACACCAGCGAGGAGCGCTTCTGCC
TTCGCTGGACGGCTCTGCTGGGTCTGGCCATGCTTGCGCC
CTGTCTGTGCTGCTACCCGCCGCTGCACGGGTGCCACCGC
TGCGGGGTGGCCTGTGGCTGCTGCGGGGGAAAGCACAAAG
CTGTGGGATGAAGCCCAAAATGACTCTAAACATGCCCCGC
GTACGCCAGCACTGAGGAGCGCAGGAGTGGACCAAACCCA
GAGCGACCACCCCGTTGTTGGAGCTTTCACTAGCTATGTT
TCCATCCACTTATTGTTATGCGCATCTTGGATTATCGCAT
GGATAACGTTTCGAAACGTTTGTAAAAAAACGTACAAACA
CAAATGAGTAGGATAAACTATGATGGAAACACTTTTACCG
AATAAATGGACCCTTTTCATATTCCCGGGTTTCTCAGTAG
CGGAAGTTGTCATAGTTTATACTGGTTTATACTTCTGCAT
TGAGTGATCGGCATGACCCACGGCGCATTCCTTGCGCGAT
GCCATGCATGTATACTTCTGCGTGCTGCTTGTGTTGCTCT
GCAGTAACACTTCTGAAACGCTAGCGCTAGGTTTTTATGT
TCCGCTGTGTCGAGTTTCTTCGCTGGTGTTCTGTTTTTTC
TGAACGCTACCTTAATGTACAAGCAGCTTAAATTCGCCCA
TTTTGAGGCAGGAACTGGCGGACGTGCAACAACTTTAATC
ATAAGGTAAACACAAAACAAAACTTTCCATCAGGAGCTCC
TTCACAGGACTCAACACTATTAAACACTCGCTCCAATGGG
TTTGCGTGGCTCTCGGCCCCGCCCACACTCGTCAACACTA
CCACGTACAGCAATCACAGAGCTTGCGCTAATCGTCGTTG
TGACGTGTAGTTACACTCTTTTGAGTGGTGTGCGTCGGCG
ATGGCCACGGCGAGGGCTATGCGAACATGCGATGGCTGCA
CCGGAGCATACCCGTGTGCTTGATGCAGAAGTATAAATCT
GCCTTTAGAATGCAGTGAATGGTAGAGTTCAACAAATATT
TTTTTACAATCCTATTTTCTGAAATAATAAAAGAAAAGCT
CCACGATGGCGTTATCAAGATGCTGCATTAGAAACACCCC
GCGTAAGCGGTAATTCGTTTTTTGTAATTGGACGCAAAGA
CGATGTAATACATACGTGAACATATATAAATGTTTATATC
TTAAAAGTTCTGACCCGTTAAACGCGTCTTGTGAAAAGGA
TGCCTTTCAGTATTAAAAAAAATTGTGCGCTATGCGTGTA
AAAAATGTGTGTGTGACGCAATAATGGACAAACCTGCGAC
CGAAAACATTGTAAAACATCGGAAATGTTGTTTTGGTCAT
TCTGAAATGCCCTAAATGCCATTTCAGTATCATCATCATT
ATTATTTTTGTTATTATTATTATTATTATTATTGTTATTA
TTATTGTTAAATTATTAATTAACTCCAGAAATGTCTTGAG
CATCTGTGTTTCGTGTCTCACGCCTCGAAATGCCACCACA
TGTCTATTGTGTGTTGACATTGTCTTTTGAGGCACAAGTA
ATTTATTAAATTAAGTTCATTTAAATTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spred2b-201 Contained in:
[BAC] DKEY-66M17 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000029385 (1),  Ensembl_Trans:ENSDART00000045292 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC066561 (1) 3039 bp
GenBank:EH443855 (1) 987 bp
CITATIONS (2)