ZFIN ID: ZDB-TSCRIPT-090929-11730
Transcript Name: gla-201
Previous Name: gla-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029321 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029321|OTTDARG00000022685|ZDB-GENE-041010-207 gla|OTTDARP00000023945 gla-001 LG_ BX005218.6 Danio rerio protein_coding KNOWN, 1483 bp
CCTGACTGACGCTGTAAACACGGAAGTAAAACAACCTGTT
ACATTCATATCATATTCAGTCATTCATCTTCACAAACCGA
CATGCGTGCCTCAATTATAGTCGTTATCGGACTTGTATGT
TTATTAGTCCCAGCCGCGGCGCTAGACAACGGCCTGGCTT
TAACTCCCACCATGGGCTGGCTGCACTGGGAGAGATTCAT
GTGCAACACAGACTGTGATGCGGATCCTCAAAACTGCATT
AGAGAGGAGCTCTTCATGCAGATGGCAGATGTGATGGTGA
AGGAGGGATGGAAGGATGCTGGATATGAGTTTGTGTGCAT
TGATGATTGCTGGCCTTCGCAACAAAGGGACGCACAGGGG
CGCCTGCAGGCAGACCCCAAAAGGTTTCCCAGTGGCATCA
AAAAACTGGCAGATTATGTCCATTCTAAAGGACTGAAGCT
GGGAATATATGCAGATGTGGGCACAAAAACTTGCGCAGGT
TACCCTGGGAGTTTGGGCTATTATGACATCGATGCAAAAA
CCTTTGCGGACTGGGGTGTGGATCTGTTAAAATTTGACGG
GTGTTTCATGCCTGACTGGCATCAGCTGGGAGAAGGTTAT
ATAAATATGTCAAGTGCACTAAACCAGACTGGCAGAAGTA
TTGTTTACTCTTGTGAATGGCCGTTATATGAGTGGCAGCA
CCAACAGCCTGACTATGAGGCAATTCGCAAGACCTGTAAC
CACTGGCGTAATTATGGAGATGTGTATGACCAGTGGACCA
GTGTGAAGAGCATCCTGGACTGGACAGCAGAAAAGCAGAA
GATCGTCGTCCCAGTGGCAGGACCAGGAGGATGGAATGAC
CCTGACATGCTGATCATTGGAAACTTCGGCTTGAGTCGCG
ATCAGCAGCAGACTCAGATGGCATTGTGGGCAATCATGGC
GGCTCCACTTCTAATGTCTAACGACCTGCGAGACATCTGT
CCCAAAGCCAAAGAACTACTGCAGAACAAGCAGATCATCG
CCATCAACCAGGACCCTCTGGGCAAACAGGGCTATCGGAT
ATTGAAGGCTGACAGTTTTGAGCTGTGGGAAAGGCCCTTG
TCAGGCAACAGGCTGGCCGTGGCAGTGATGAACAGACAGG
AGATTGGAGGTCCGCGCAGATTTACTATTTCAGTGGCAAT
AATGCCTAGCTGGAAGCTTTGTAACCCGAAATGCAACGTA
ACCCAGATCATGCCCACTTACAAGGAAATGGGCGTCCAAA
ATCTCTTGTCAGAGGTGGTGGTCCAAGTCAACCCTACAGG
CACAACACTACTCACCGTCAACCCACTGTGAACTAGAGCC
AAGACAAAGAAATGGGACTAATACTGTTGAATTACATGAC
TTGAAGTCTTTCTTTTTGAATACTGCTTTTGAATCTATTT
GAATTTTTTAAGTGAACTTAGAGCAATCAAAAGATTACAA
TTGTAGCTGTGGATCATTTTATTAAACAAAAAACACTGAC
AAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gla-201 Contained in:
[BAC] CH211-127L12 (1)

Genome Resources: Vega_Trans:OTTDART00000029321 (1),  Ensembl_Trans:ENSDART00000139293 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC083209 (1) 1496 nt
GenBank:BC164755 (1) 1084 nt
GenBank:EE692813 (1) 899 nt
GenBank:CA474953 (1) 846 nt
GenBank:CN014034 (1) 787 nt
GenBank:CO814055 (1) 782 nt
GenBank:DV587453 (1) 774 nt
CITATIONS (2)