ZFIN ID: ZDB-TSCRIPT-090929-11708
Transcript Name: zgc:77938-201
Previous Name: zgc:77938-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029298 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029298|OTTDARG00000022673|ZDB-GENE-040426-1910 zgc:77938|OTTDARP00000023929 DKEY-5I20.3-001 LG_ CT009687.10 Danio rerio protein_coding KNOWN, 1357 bp
ACTAGTACCAGCAGTTCCTCTCCCGAGCCCTGACAAAAAC
AGCTCTGAGGCTGATTACATAAAACTGTACTACAAGATTG
TGGTTACCATGGAAACTGAAGGAAAGGTGATCAAGTGCAA
GGCAGCAGTGGCCTGGGAACCAGGAAAACCACTGTCTATT
GAGGATGTAGAGGTCGCCCCTCCCAAAGCTCATGAAGTAC
GGATCAAGATGGTGGCATCTGGAATATGCCATACCGACTG
GACTTTCCTACATGAAGTTGGTAAAACAATGAATCCACAG
CCTTTTCCTGTGGTTTTGGGGCATGAAGGGGCCGGAGTGG
TGGAGAGTGTTGGTCCAGGTGTCACAAAGATGGCCAAAGG
TGATAAAGTTATTCCTTTAGTCGTGCCACAGTGTGGACAA
TGTGAACGTTGTCTAAGTCCAAAGACAAACCTTTGCTCTA
AAAACTGGGAGAAAACTCAGCAATGCCTTCTTGCTGATGG
CACCAGCAGGATTACCTGTAAGAATCAGCAGGTTCATCAG
TTTATTGCTATCAGCACTTTCTCTGAATATACGGTTGTGC
CAGAAGACAATGTGACCAAGATTCACCCAGACGCTCCACT
GGACAGAGTGTGTTTGCTGGGTTGTGGAGTTTCTACAGGA
TATGGGGCAGCAGTGAACACAGGCAAAGTGGAATCTGGCT
CCACATGTGCAGTGTTTGGTTTGGGAGCTGTGGGACTTGC
AGCTGTCATGGGATGCAAAGCTGCCGGTGCCACCAGAATC
ATCGCTGTTGACATCAATTCAGACAAGTTTGAGATCGCCA
AGACATTTGGCGCGACTGAGTTTGCGAATCCTAAAGACCA
CAGTAAACCCATTCAGGAGGTGTTAAGGGAGCTGACAAAT
GGTGGGGTTGACTACGCTCTTGAGTGTGTGGGCAATGTGG
GGGTTATGAGGGCAGCTGTGGAAGCCTGCAGTCCAGCAGG
AGGAGTCTGTGTGATGGTGGGCTGGACCCGGATGGGGGAA
CTTACCCTGGTCTCTGAGGATATTCTGCTGGGAAAAACTT
TGAAAGGCTCCTATTTTGGTGGTTGGAAGAGTGTTGAGGC
AGTCCCCAAGTTGGTGCAGGAGTATCTGAGTGGGAAGATT
CTCCTGGATGAGTTTGTGACTCACAGACTGACTCTAGATC
AGATTAACGAGGCCTTTGATCTCATGATCACCGGAAAAAG
TATTCGCACAGTGATCCAGATGTGAGATGAAGGAATGAAG
ATCTGCCTCAAACAGAACAGTATTTACAGCATTTTCAGAC
ATCACATACATCACAGAAGAATCAATGTTTTATAATAAAA
TGCACTCAAGCTGCATGGATCTCAGCAGTTTAGATCA

zgc:77938 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zgc:77938-002 (1) 776
mRNA zgc:77938-201 1357
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:77938-201 Contained in:
OTHER zgc:77938-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029298 (1)
  • Ensembl_Trans:ENSDART00000105604 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065900 (1) 1367bp
    GenBank:EE692108 (1) 930bp
    GenBank:DN836441 (1) 759bp
    CITATIONS (2)