header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11709
Transcript Name: zgc:77938-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029299 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029299|OTTDARG00000022673|ZDB-GENE-040426-1910 zgc:77938|no_translation DKEY-5I20.3-002 LG_ CT009687.10 Danio rerio protein_coding KNOWN, 776 bp
GTGATCAAGTGCAAGGCAGCAGTGGCCTGGGAACCAGGAA
AACCACTGTCTATTGAGGATGTAGAGGTCGCCCCTCCCAA
AGCTCATGAAGTACGGATCAAGGTAAATCCGTTACATTTC
TCTACGATACTACATTAATTTAAGATATTACTTTGATCAG
TGGCAAGGCAGTATTTATTTATCAGCTCACTGACTATGAA
TTGACCCGGGTCAGATGGTGGCATCTGGAATATGCCATAC
CGACTGGACTTTCCTACATGAAGTTGGTAAAACAATGAAT
CCACAGCCTTTTCCTGTGGTTTTGGGGCATGAAGGGGCCG
GAGTGGTGGAGAGTGTTGGTCCAGGTGTCACAAAGATGGC
CAAAGGTGATAAAGTTATTCCTTTAGTCGTGCCACAGTGT
GGACAATGTGAACGTTGTCTAAGTCCAAAGACAAACCTTT
GCTCTAAAAACTGGGAGAAAACTCAGCAATGCCTTCTTGC
TGATGGCACCAGCAGGATTACCTGTAAGAATCAGCAGGTT
CATCAGTTTATTGCTATCAGCACTTTCTCTGAATATACGG
TTGTGCCAGAAGACAATGTGACCAAGATTCACCCAGACGC
TCCACTGGACAGAGTGTGTTTGCTGGGTTGTGGAGTTTCT
ACAGGATATGGGGCAGCAGTGAACACAGGCAAAGTGGAAT
CTGGCTCCACATGTGCAGTGTTTGGTTTGGGAGCTGTGGG
ACTTGCAGCTGTCATGGGATGCAAAGCTGCCGGTGCCACC
AGAATCATCGCTGTTG

zgc:77938 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zgc:77938-002 776
mRNA zgc:77938-201 (1) 1357
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:77938-002 Contained in:
OTHER zgc:77938-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029299 (1)
  • Ensembl_Trans:ENSDART00000133164 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DR723172 (1) 775bp
    CITATIONS (2)