Transcript

lipia-201

ID
ZDB-TSCRIPT-090929-11654
Name
lipia-201
Previous Names
  • lipia-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029235 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029235|OTTDARG00000022640|ZDB-GENE-040801-242 lipia|OTTDARP00000023884 DKEY-71D15.1-001 LG_ CR388019.9 Danio rerio protein_coding KNOWN, 1777 bp
ATGTTTGTAGGAATGGTGGGTGGAGCTGTAAAGGAGGAGC
TGCTCAGCAAGTGTCTCCTTAGTATTTCCTGGTCTGTTCA
AATGAAATGCTTGAAACACTCATAGTAAACTCTTACCGTC
AGATGTAAATGATTGCTCCTCCAACATGATCTACAGGAAA
ATAATTTGGGGGATCTTATATGTCACACTGATGTTGTTTG
ACACACACAGAGCTCAGGAATGTGAAGAGATGACAGACCT
TAACTTTAAAGACTCCCTCGCTGGTACATCTTTGAAAGTT
AGACTGCTGCTTTACACACGAGCTGATCCGTCCTGCGGTC
AGCTGCTTTCTCACCAGGAGCCCTTCAGTAATTCCCAATT
CAACGTCAGCTCTGTTACCACCTTCCTCATCCATGGGTAC
CGGCCCACCGGCTCACCCCCTGTTTGGATGAAACAATTTG
TGGAGTTCCTTCTGAACCGCCGCGATATGAATGTTATCGT
GGTGGATTGGAATCGTGGAGCAACCAACATGAACTACTGG
CAAGTTGTGAAAAATACACGCAAGGTGGCTAATAATCTTA
CGGACCTCATCCAAAAAATGAAGGACAATGGGGCCAATCT
CAGCTCTATACACATGATAGGTGTCAGTCTGGGAGCCCAC
ATTTCAGGTTTCACTGGGGCCAACTTTAATGGTGAAATTG
GTAGAATAACAGCACTGGATCCAGCAGGGCCAGAGTTCAA
CGGTCGGCCCCCTGAGGACCGTTTAGACCCTTCTGATGCC
CTGTTTGTGGAAGCCCTACACACAGACATGGATGCATTAG
GCTATCGAAATCTTCTGGGTCACATCGACTACTACGCCAA
TGGAGGGGCAGATCAGCCAGGATGTCCTAAAACCATCCTA
TCAGGATCCGAGTATTTTAAGTGTGACCACCAGAGGTCAG
TGTTTCTCTATATGAGTTCCGTGAACGGCTCCTGTCCCAT
TATTGCCTACCCCTGTGAATCCTACACTGACTTCCAAGAC
GGGACGTGCATGGATTGTGGGAAATTTAAGTCAGCCGGAT
GCCCTATTTTTGGTTATGATTCTGTACGCTGGAGGGACAC
CCTGGTGCAGCTTGAACAAACAAGGACATATTTTCAAACG
AATAAAGCTTCTCCGTTCTGCAAGGTTGGCTACAAGGTTG
ATATCGTATCGTGGAACCAGAAAACCCACTGGGGATATTT
GACAATTAAATTATCCAATGGAACTGAAGAGACACAAGTA
GAACTCAATCATAAATCCTTAAAGTTCGAGAGGTTTCAGG
AGACCTCTGTCCTGGCTCAGTTTGAGAGAGACATTCAGCC
TGTTAAAAAGATCACACTGAAGTTCTGCCCCAGAAAAGGA
CTGCGGCCACGCAAGAAACTGCGGCTTCTGCATATACGCC
TCACTCCTCTACAGAACCACCTCAGGCCTCTGTGTCGCTA
CGATCTTCTGCTGGAGGAAAGTAAAGATGTGACCTTCAAA
CCTATTCCATGTGAAGACTCCAACTTTTGATTCAAAAGTT
CAAACAAGGACATTCCATAACAAAACCACTGCCTCCTTTA
ATCAGTTACTGAAATAGCTTTCATTTGTAGTGTTTAACTG
GAAATAATCTATAATTGTTCATGTTAAGTTTGCATCATGT
TTCTTTAATAAGTTGTCATCCCTTCAGAATTTATAATTTA
CTATGTGTTGTGTTGTTGTTTTCATCTACACTTATATTAA
CGGTACATCTACATTTGGTTTTTAAGTAATGTAAATAAAT
ATTTTTGTAAGAATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations