ZFIN ID: ZDB-TSCRIPT-090929-11624
Transcript Name: rab41-201
Previous Names: rab41-001, zgc:63637-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029201 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029201|OTTDARG00000022625|ZDB-GENE-040426-2686 rab41|OTTDARP00000023860 rab41-001 LG_ BX571981.5 Danio rerio protein_coding KNOWN, 2482 bp
ACAGTGTGTCCTTCGTCCACGCACGACAATAACATTTAGA
AAGCTGTTGTTCAGTATATTCGATAAACATGTCCACTACG
ACCGGTGGCGGAGAGTTCGGCAACCCTCTGCGGAAATTTA
AGCTGGTTTTCCTGGGCGAGCAAAGCGTGGGCAAAACTTC
ACTTATCACCAGGTTTATGTATGACAGCTTTGATAATACT
TATCAGGCAACTATTGGTATAGACTTTTTGTCAAAAACCA
TGTACCTGGAAGATCGCACGGTTCGGCTCCAGCTGTGGGA
CACTGCAGGGCAGGAGCGCTTCCGCAGCCTCATTCCCAGC
TACATCCGAGACTCCACTATTGCTGTGGTGGTCTATGACA
TCACCAATCTTAACTCTTTCCAGCAAACCTCAAAGTGGAT
AGATGATGTCAGAACAGAGAGAGGAAGTGATGTTATTATC
ATGTTGGTTGGCAACAAGACAGACCTGGGTGATAAAAGGC
AAGTGTCAGTAGAGGCAGCAGAGAAAAAAGCTCGGGAACT
GGGGGTGATGTACATAGAGACCAGCGCCAAAGCTGGCTAT
AACGTCAAACAGCTGTTTCGTCGTGTTGCTGCTGCTTTGC
CTGGAATGGATAGTACACCAGAGAAGAGCAAAGAGGACAT
GATCGACATCAAACTGGAGAAGCCTCCGGAGTTGCCCGTT
ACCGAAAGCAGCTGCTCGTGCTAGTAAACCACCCTCATCC
CCCAGCAGGCCCTACGCCCCCCCTCCCACTCAACCCCCTC
TCACACACACACACAGCTTGCCTCTCAGTGGTCACTCACT
CCTCTCACGGCCCCATGTCACGAGCCAAGAACCCTTTCTT
TCTCTTCGACTCGGTGACTTCTCAGAGTAACCGTGTGGAT
GTGCTACAACTCTGAATTCAAACGGATTCCAAAACATGTA
TAATAATGGGGGGAAAACGTAAATCAAAGCATATTTTAAA
TGCGAAAAATCTGTTCTGGCTGCATGGCATTAAATGGGAC
TGCAGACTGACATAAGCTCATATGCTCTTGAGTTTTCACA
CATCAGTGCTGTCATAGTCATTGTGAAGTGTTTCAGAGCC
TGGGCTGATGTCCTCTTGTTTTTTTAAGGGCCTTTTTAAG
AAATTACACTGGAGGAAAAGGTTGAGATTGTTGTGTTGAG
AGGCTGTAAACTTCTGTTACCAAGTTGTTTTGTTTTTTAA
ACACACTATTTTGTTGGCAGAAGTTATTTAATCTGATTTT
GAAATGGTCATATCATTAATATTCTGTATAATTGGGTGTT
TTTTTTTGTGTTATAAGCGGTATTAGGGACCAGCTATCAG
TTAAAGGTCTTTTTGTTTCAAGAAAGATTCACGTTCGGCC
AATAATTGAGCAGTTTTGTTTACGAGAGAGGTCTCATTCG
AGAACAGGCTGATTTTATATTCGGAGGGTTGCATGGAGGT
CGAATGTATTGAGTTGTGAGGGGGGGGATTTTGGATTTAA
CATTCTTAGAAAAGGGAAAAATTGCTTTGTAAACATATTT
TTATTTCATCAAAACTAAAAGCCTAAGATATTTAATGACT
TATCCACAACTTTAATGGTAAAAACAAACCCTGTATGTAC
TAACAAAACTATGGTAACTGAGCTTGGATATGGAAAGCAT
CAGCAATTCACACTAATTCCACTCATCATTTTCTGCCTTG
TTTTTGCTGTGCGAGTGTAGGAGCAGCATGCAGTTTAGAG
ACGGTTTAACACAAAATTGCCTTGCTTGTTTTGTTGTCAT
AGTGCACCAGATCAGGCCGCAGCGCTGTGCTTTGCTCCAG
CCTGTTAACATTGCATAGAGCTAACGAGTTTTTGAGTTTG
GGATGTTTCGATTTCCTCTTTCGACACGGCTATCGCTTGG
TGTACAGACATGTCTTAGTATTGCTTGTCGTAAGACTGTT
GGTTTCATGTGTTTATTTATTATCTCACTAGTTAGTGAAA
GTGTGTCGTATGCTTGACAGGAATGGCAGCAATGTGCAGG
AATCAAAGGTTGATGTGTAATTTGCATTGCTGCCTGGCTA
CTGTATCGCAAAAACCTGCTCATGTCACTCTCCTCTTGCC
ACAAGTCCCATCTGTAACGCTGGGTTTCTTCAGTATAGCT
TGAGTGGGCTTTTATTTGCTGGCGGAAACCCCTCAGCACT
GTCGCTTTTCCTCTCATTCGACGGCAAATCCTGAAAAACA
AGGGCATCAGGTGCGTTTTAAACGTTAACATTTAATATGG
TTTGATTATGTAAGAATTGACATAAGAGTGAAAACCCTCC
TGAACAGCTCTGTCACTCGTCACTGACTGAATACTCAGCT
GTGTGCTCTTCTAAAGTGTGTTGGTCTGTTTGAAATACGC
TGTCTACTAGTGTTTAGCAAAGTTTGTGTGAACAAAGTAC
TATTATTATTATTATATGCTGTAAAAAATGGAAGGTTAAA
GAGACACCAAATGTATCACATGAATAAAAGATATTTCACC
AA

rab41 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rab41-201 2482
rab41-202 (1)    Ensembl 2513
rab41-203 (1)    Ensembl 805
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rab41-201 Contained in:
[BAC] DKEY-31J3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000029201 (1),  Ensembl_Trans:ENSDART00000045555 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC058059 (1) 2498 nt
GenBank:CN013538 (1) 942 nt
GenBank:EE320716 (1) 912 nt
GenBank:BM890551 (1) 645 nt
CITATIONS (2)