ZFIN ID: ZDB-TSCRIPT-090929-11625
Transcript Name: rab41-202
Previous Names: rab41-002, zgc:63637-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029202 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029202|OTTDARG00000022625|ZDB-GENE-040426-2686 rab41|OTTDARP00000023861 rab41-002 LG_ BX571981.5 Danio rerio protein_coding KNOWN, 2513 bp
ATCCGCTATCGGCGCTCCGTCACTGGACTGTACAGTGTGT
CCTTCGTCCACGCACGACAATAACATTTAGAAAGCTGTTG
TTCAGTATATTCGATAAACATGTCCACTACGACCGGTGGC
GGAGAGTTCGGCAACCCTCTGCGGAAATTTAAGCTGGTTT
TCCTGGGCGAGCAAAGCGTGGGCAAAACTTCACTTATCAC
CAGGTTTATGTATGACAGCTTTGATAATACTTATCAGGCA
ACTATTGGTATAGACTTTTTGTCAAAAACCATGTACCTGG
AAGATCGCACGATTCGGCTACAGCTGTGGGACACTGCTGG
GCAGGAACGCTTCCGTAGCCTCATTCCCAGTTACATCCGA
GACTCCGCAGCCGCAGTGGTGGTCTATGATATAGCAAATC
TTAACTCTTTCCAGCAAACCTCAAAGTGGATAGATGATGT
CAGAACAGAGAGAGGAAGTGATGTTATTATCATGTTGGTT
GGCAACAAGACAGACCTGGGTGATAAAAGGCAAGTGTCAG
TAGAGGCAGCAGAGAAAAAAGCTCGGGAACTGGGGGTGAT
GTACATAGAGACCAGCGCCAAAGCTGGCTATAACGTCAAA
CAGCTGTTTCGTCGTGTTGCTGCTGCTTTGCCTGGAATGG
ATAGTACACCAGAGAAGAGCAAAGAGGACATGATCGACAT
CAAACTGGAGAAGCCTCCGGAGTTGCCCGTTACCGAAAGC
AGCTGCTCGTGCTAGTAAACCACCCTCATCCCCCAGCAGG
CCCTACGCCCCCCCTCCCACTCAACCCCCTCTCACACACA
CACACAGCTTGCCTCTCAGTGGTCACTCACTCCTCTCACG
GCCCCATGTCACGAGCCAAGAACCCTTTCTTTCTCTTCGA
CTCGGTGACTTCTCAGAGTAACCGTGTGGATGTGCTACAA
CTCTGAATTCAAACGGATTCCAAAACATGTATAATAATGG
GGGGAAAACGTAAATCAAAGCATATTTTAAATGCGAAAAA
TCTGTTCTGGCTGCATGGCATTAAATGGGACTGCAGACTG
ACATAAGCTCATATGCTCTTGAGTTTTCACACATCAGTGC
TGTCATAGTCATTGTGAAGTGTTTCAGAGCCTGGGCTGAT
GTCCTCTTGTTTTTTTAAGGGCCTTTTTAAGAAATTACAC
TGGAGGAAAAGGTTGAGATTGTTGTGTTGAGAGGCTGTAA
ACTTCTGTTACCAAGTTGTTTTGTTTTTTAAACACACTAT
TTTGTTGGCAGAAGTTATTTAATCTGATTTTGAAATGGTC
ATATCATTAATATTCTGTATAATTGGGTGTTTTTTTTTGT
GTTATAAGCGGTATTAGGGACCAGCTATCAGTTAAAGGTC
TTTTTGTTTCAAGAAAGATTCACGTTCGGCCAATAATTGA
GCAGTTTTGTTTACGAGAGAGGTCTCATTCGAGAACAGGC
TGATTTTATATTCGGAGGGTTGCATGGAGGTCGAATGTAT
TGAGTTGTGAGGGGGGGGATTTTGGATTTAACATTCTTAG
AAAAGGGAAAAATTGCTTTGTAAACATATTTTTATTTCAT
CAAAACTAAAAGCCTAAGATATTTAATGACTTATCCACAA
CTTTAATGGTAAAAACAAACCCTGTATGTACTAACAAAAC
TATGGTAACTGAGCTTGGATATGGAAAGCATCAGCAATTC
ACACTAATTCCACTCATCATTTTCTGCCTTGTTTTTGCTG
TGCGAGTGTAGGAGCAGCATGCAGTTTAGAGACGGTTTAA
CACAAAATTGCCTTGCTTGTTTTGTTGTCATAGTGCACCA
GATCAGGCCGCAGCGCTGTGCTTTGCTCCAGCCTGTTAAC
ATTGCATAGAGCTAACGAGTTTTTGAGTTTGGGATGTTTC
GATTTCCTCTTTCGACACGGCTATCGCTTGGTGTACAGAC
ATGTCTTAGTATTGCTTGTCGTAAGACTGTTGGTTTCATG
TGTTTATTTATTATCTCACTAGTTAGTGAAAGTGTGTCGT
ATGCTTGACAGGAATGGCAGCAATGTGCAGGAATCAAAGG
TTGATGTGTAATTTGCATTGCTGCCTGGCTACTGTATCGC
AAAAACCTGCTCATGTCACTCTCCTCTTGCCACAAGTCCC
ATCTGTAACGCTGGGTTTCTTCAGTATAGCTTGAGTGGGC
TTTTATTTGCTGGCGGAAACCCCTCAGCACTGTCGCTTTT
CCTCTCATTCGACGGCAAATCCTGAAAAACAAGGGCATCA
GGTGCGTTTTAAACGTTAACATTTAATATGGTTTGATTAT
GTAAGAATTGACATAAGAGTGAAAACCCTCCTGAACAGCT
CTGTCACTCGTCACTGACTGAATACTCAGCTGTGTGCTCT
TCTAAAGTGTGTTGGTCTGTTTGAAATACGCTGTCTACTA
GTGTTTAGCAAAGTTTGTGTGAACAAAGTACTATTATTAT
TATTATATGCTGTAAAAAATGGAAGGTTAAAGAGACACCA
AATGTATCACATGAATAAAAGATATTTCACCAA

rab41 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rab41-201 (1)    Ensembl 2482
rab41-202 2513
rab41-203 (1)    Ensembl 805
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rab41-202 Contained in:
[BAC] DKEY-31J3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000029202 (1),  Ensembl_Trans:ENSDART00000075056 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC097051 (1) 2542 nt
GenBank:EH500976 (1) 900 nt
GenBank:CK239743 (1) 826 nt
GenBank:CT694423 (1) 818 nt
GenBank:FP134454 (1) 680 nt
GenBank:FP122889 (1) 630 nt
GenBank:FP202268 (1) 575 nt
CITATIONS (2)