Transcript

zdhhc2-201

ID
ZDB-TSCRIPT-090929-11511
Name
zdhhc2-201
Previous Names
  • zdhhc2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029081 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029081|OTTDARG00000022557|ZDB-GENE-050320-58 zdhhc2|OTTDARP00000023776 zdhhc2-001 LG_ CR384105.16 Danio rerio protein_coding KNOWN, 2610 bp
CCGGAGGATGGAGAAGCAGAAGAGCCGCAGCCGCGCACCG
GAAAACATATGATGTTTTAGCAGCAGCAGTGCGGGCTCCA
CTTGACGTTTTGACCACTTTTGGTCATCAAATAGAAAGAT
GGCGCCGTCGGGCTCGCGCAGCTTTGACTGCTGGAGAGTT
TTATACTGGATCCCCGTGCTGTTCATCAGTCTGATCGTGG
CATGGTCCTACTACGCTTATGTAGTGCAGCTCTGCATAGA
AACCATTGAAAACATGGGAGAGAAAACAGTTTACCTGCTG
ATATATCATCTGCTGTTTCTGATGTTTGTGTGGTCATACT
GGCAAACCATTTACTCAAAACCAATGAACCCGCTCAAAGA
GTTCCACCTGTCACATGTTGACAAAGAGCTATTAGAGCGT
GAAGACCGGCGAGAATCTCAACAGGAGATCTTGAGGAGAA
TTGCTAAGGATTTGCCCATTTACACACGCACCATGTCAGG
AGCAATCCGCTACTGTGATCGCTGTCTGCTGCTGAAGCCT
GATCGATGCCATCATTGCTCCGCCTGTGATATGTGCATTT
TAAAGATGGATCACCACTGTCCGTGGGTTAACAATTGCGT
GGGCTTTGCCAACTACAAGTTTTTCATGCTCTTCCTAGCA
TATTCCTTGTTGTATTGCCTTTTTGTCACTGCCACAGACA
TGCAGTATTTCATCCAGTTTTGGACTAATGGTCTGCCTGA
TACTCAAGCCAAATTCCACATCATGTTCCTGTTTTTCGCC
GCCTCTACATTCTCAGTCAGCCTAGCGTTTCTGTTTGCTT
ATCACTGCTGGCTTGTCTGCAAGAACAGATCCACTTTGGA
GGCGTTCAGAGCTCCTGCATTCCAGCATGGGACAGACAAG
AACGGCTTCAGTTTAGGAGCATACAAAAACTTTCGCCAAG
TGTTTGGGGATGAAAAGAAATATTGGCTTCTGCCTATTTT
TTCAAGTTTGGGCGACGGCTGTTCATTCCCCACCTGTCTA
GTGAATCCAGACCCTGAACAACCTTCTATACCACCTGGAC
GAAACCCTTCAGTCAAGAGTGCTGGAGAATCGCATCCGTT
TCCTCCTAAACCTCTGAGAGAGTCACAGAGTCGCCTGCTG
AACAACGGACAGACAGACGGAAGTGAAGACCGAGACAAGC
GAGGCACAAGCAACCCAGCCTTGACTATTGAGAAGGAAAC
TTAGAAACAGGACTTCTGTGCTTGTGATCTCTGATGAGTG
AGATGTTTCTGCTGCTCTAAAATTGTCTATCACTGTCCAC
CTAAAGGCTTGAGATCTTTCACAAGAGCAAACAGTGCAGG
ATTGTGGTCTGTACATACACGAAGACATACACGCAGAGTC
TCCTTTCCTGCTCGGAAACAGTATGGCAGAGAAATCTTAA
CGTGCCTAAAGAAGCCCACAAATGTGGCTGAACATTTGGA
AACATGACCGTGGTGCTAACTAGAAACCACATCTTAAAGA
ACAACAACAAAAAAAGTAGACATTTGTATGGTAAATGCCT
TGAATATAGCTTGTGTGGTGTAGGCAGTGCTGAAAAAGGT
TTTTGTGAGTCTGGGAAATGTTCAGTATTTATGCATGCAT
GTGTGATGATGGTACTTTGTCGTTTGTCATGTTTGAAGTG
TGAAAACCGAAAAGTGTTTCTGCGCTAAACGTTATTCAGT
TTTTGATTGAAATGCAGCGTTGAACTGTTTTGATTCATTA
CTAAACAAATGCATTTGCACATTTGTAAATATAATCTGTT
CTATTTGACAAAGTGTCAAAGAAGAGCTTGTCCGTTACCC
TTAAGTCTGGATCTCAGCTGTAAAGGTCACTTACAAGCAA
AACGACTGATGTAGCAAAAACTGAAGGCTATTTTTAGTGC
TGGATATATTCAGACGAAAGCACGGTTTATTCAAGTTTTT
ACCTGACAAGCACAGGGAAGACAAAAAATGCTCGATATGC
ACTTTGAACAGCGCTTGAAGCTGCACTTATTTTTCACATT
TCCAATTGTCTGTTTGTTTGTTTTTTCATTACAGTTCTGT
CAAATTAAATATGCAAGGAGTCTTGTGTCCTTGTGTGTTA
TTAAACTGCAGACATTGTTAAAAATGACTGTATATATAAA
TATATATTCGAATATTTTTAGCATAATCCTGTTTGCACAA
TTAATGCAAAAATCAAGAGATGTGGTTTTGGTATCATGTC
TGATTAATCTAAGGGCTCTATTAATGTACTTTCTTATCTG
GATTTGATTGCATGTTAATACACTTGATTTTGACTGAGGT
GTAACGAAACCTCTGAAATGCCAAGAGTTGTGGTGTGTTA
TCTGTTTTGTAGTTTTTAAGTCGTACAGTAATTCTGTTCT
TTTGAGATTAGTTTCACGCACCACATTAAAAGAAACTTTG
ATTTCTACTGGTTCTTGCTTTGGTGTCCTTTAGACTGTTG
TAGCTGCTTTTGTTATCTTTGAGAGTGTGAATGTGAACTT
CTGCTGGCTCTCTGCGTATGTAGCTTAATGTTTTCACGAA
AGTCAGACTCTGTATGACAACGCCATTGAAGGATATGCCT
TGATGAGTGTTAATGTAAAAAATAATAAAATGATATTTTA
TTAAACGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations