ZFIN ID: ZDB-TSCRIPT-090929-114
Transcript Name: arg1-201
Previous Names: arg1-001, si:ch211-146f4.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002205 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002205|OTTDARG00000002056|ZDB-GENE-040724-181 arg1|OTTDARP00000001953 CH211-146F4.3-001 LG_ AL732629.6 Danio rerio protein_coding KNOWN, 1041 bp
AGTATCACTACAGTGATGATGAAGATGAAGAGCCTTAGCG
GATCACGAGCAGCTCTTCACATATTCAGGAGACACCTCCA
TCATCAGCGGTACTCTGTGGGAATAATAGGCGCTCCGTTC
TCCAAAGGACAGCAGAAGGATGGTGTGCAGGAAGGAGCAG
ACCTCATTCGAGCCGCTGGACTGGTGCAGAAACTTAAAGG
GCAAGGTTGTGTGGTGAAGGATTATGGGAATGTGACATTT
GAAAACCTTCCCAACGACGAGTCCATCGGGAGACTCAAGA
CCCCGAGAGCGGTGGGACGAGCAAATGAGCTGCTTTCAGG
GGCTGTGCAAAAGATCAAGAGTGATGGAAACACATGCGTG
ATGCTGGGAGGAGATCACAGCCTGGCGATCGGCTCAATCT
CTGGTCATGCTGCATACAGACATGAGCTGAGTGTTTTATG
GGTGGACGCACACGCAGACATCAACACACCTTTAACCACA
CCGACTGGAAATATTCACGGCCAGCCGATGTCTTACCTCA
TCCACGAACTGCACTCCAAGATGCCCAAACTTCCAAATTT
CTCATGGCTAAAGCCTTGCATAGCAGCTCAGGATGTTGTG
TATATTGGACTCCGAGACGTGGACCCGGAAGAACATTATA
TCCTTAAATACCTGGGCATCAAAACCTTCTCCATGACTGA
AGTTGATCGACTTGGAATAGCAAAAGTCATGGAGCAGACG
TGTGATCACATGTTTTCAAAAGTGAAGAAGCCGATCCATC
TGAGTTTCGACATTGATGCGCTGGACCCGTCAGTGTCACC
GGCGACTGGCACACCTGTAGCAGGAGGACTGACCTATAGA
GAGGGCATTTACATCACTGAGCACATCTGCCAAACAGGGC
TTCTCTCTGCTGTAGACATGGTGGAAGTGAACCCCAAACT
GGGCAGAACAGCGGACGAGATCAAATCAACAGTAAACGCT
GCTGTGGATCTGCTGCTGGGCTGCTTTGGACGGATTCGCG
AAGGCTCTCATGACCCAGATTACAAAATGCCAAATCCATA
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arg1-201 Contained in:
[BAC] CH211-146F4 (1)

Genome Resources: Vega_Trans:OTTDART00000002205 (1),  Ensembl_Trans:ENSDART00000106267 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE302186 (1) 820 nt
CITATIONS (2)