Transcript

arg1-201

ID
ZDB-TSCRIPT-090929-114
Name
arg1-201
Previous Names
  • arg1-001
  • si:ch211-146f4.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002205 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002205|OTTDARG00000002056|ZDB-GENE-040724-181 arg1|OTTDARP00000001953 CH211-146F4.3-001 LG_ AL732629.6 Danio rerio protein_coding KNOWN, 1041 bp
AGTATCACTACAGTGATGATGAAGATGAAGAGCCTTAGCG
GATCACGAGCAGCTCTTCACATATTCAGGAGACACCTCCA
TCATCAGCGGTACTCTGTGGGAATAATAGGCGCTCCGTTC
TCCAAAGGACAGCAGAAGGATGGTGTGCAGGAAGGAGCAG
ACCTCATTCGAGCCGCTGGACTGGTGCAGAAACTTAAAGG
GCAAGGTTGTGTGGTGAAGGATTATGGGAATGTGACATTT
GAAAACCTTCCCAACGACGAGTCCATCGGGAGACTCAAGA
CCCCGAGAGCGGTGGGACGAGCAAATGAGCTGCTTTCAGG
GGCTGTGCAAAAGATCAAGAGTGATGGAAACACATGCGTG
ATGCTGGGAGGAGATCACAGCCTGGCGATCGGCTCAATCT
CTGGTCATGCTGCATACAGACATGAGCTGAGTGTTTTATG
GGTGGACGCACACGCAGACATCAACACACCTTTAACCACA
CCGACTGGAAATATTCACGGCCAGCCGATGTCTTACCTCA
TCCACGAACTGCACTCCAAGATGCCCAAACTTCCAAATTT
CTCATGGCTAAAGCCTTGCATAGCAGCTCAGGATGTTGTG
TATATTGGACTCCGAGACGTGGACCCGGAAGAACATTATA
TCCTTAAATACCTGGGCATCAAAACCTTCTCCATGACTGA
AGTTGATCGACTTGGAATAGCAAAAGTCATGGAGCAGACG
TGTGATCACATGTTTTCAAAAGTGAAGAAGCCGATCCATC
TGAGTTTCGACATTGATGCGCTGGACCCGTCAGTGTCACC
GGCGACTGGCACACCTGTAGCAGGAGGACTGACCTATAGA
GAGGGCATTTACATCACTGAGCACATCTGCCAAACAGGGC
TTCTCTCTGCTGTAGACATGGTGGAAGTGAACCCCAAACT
GGGCAGAACAGCGGACGAGATCAAATCAACAGTAAACGCT
GCTGTGGATCTGCTGCTGGGCTGCTTTGGACGGATTCGCG
AAGGCTCTCATGACCCAGATTACAAAATGCCAAATCCATA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations