ZFIN ID: ZDB-TSCRIPT-090929-11247
Transcript Name: tmem9-202
Previous Name: tmem9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028804 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028804|OTTDARG00000022385|ZDB-GENE-030131-6083 tmem9|OTTDARP00000023555 tmem9-002 LG_ BX544876.8 Danio rerio protein_coding KNOWN, 865 bp
TTCATGAACTTCCGGGAAAAGTCAACAAATGCGTTGATGC
GTCATGTCCTTCATTGCACAAAGTCTCCGGACACCAGTAA
TTTTCCTGGCGTTTCTTGTTCTCATAGAAGTGGTGTCGTT
TGCTTCTGCAGATAAGAGTTTTGAAGATGTGCGTTGCAAG
TGCATCTGTCCACCTTACAGAAACATCACTGGACATATAT
ACAAAAAGAATGTGACCCAGAAAGACTGTAACTGTCTGCA
TGTGGTGGAGCCCATGCCAGTGCCTGGTCATGATGTGGAG
GCCTACTGTCTGCTGTGTGAGTGCAAGTATGAAGAACGAA
GCAGCAACACCATCAAGGTGACCATTATCATCTACTTGTC
AGTGGTCGGAGCTCTTTTACTGTACATGCTATTCCTGCTT
CTGATTGATCCTCTGATTCGCAAACATGATCCGTACACCA
TGCCACTGCAGAATGAGGAGGATTCAGAGGATGTGAGGCC
ACGTGTGGACGGTGCTCGTGGAAATACAGTGCTTGAGAGG
GTGGAGGGAGCTCAGCAGCGCTGGAAGAAACAGGTCCAGG
AGCAGCGCAAGACTGTGTTCGATCGCCACAAGTTGCTCAG
CTAAGCCTTTAGACAGAGAAAACAACAAAATGGCTGCACT
GTCTGAGAATACTTGCATGGTGGTCTTTCAGTTTCAGCTT
TTATGACAATATAATTATCAGTGAATCTACTGCTTGTACA
ATATTATTAGACTTATAATCGTACCAAGGCTTACTTTGTT
ATATTAAATTCTTAAACTGAATTTGTGAAAGCATTAAGCT
GGTAAAAGAATAGTTTATCCGAAAAATAATGTGATTTATT
TATTTATTTTTAACTAAATATAGGA

tmem9 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA tmem9-201 (1) 2058
tmem9-202 865
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem9-202 Contained in:
OTHER tmem9-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028804 (1)
  • Ensembl_Trans:ENSDART00000137899 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN841186 (1) 854bp
    GenBank:BM957806 (1) 676bp
    CITATIONS (2)