ZFIN ID: ZDB-TSCRIPT-090929-11246
Transcript Name: tmem9-201
Previous Name: tmem9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028803 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028803|OTTDARG00000022385|ZDB-GENE-030131-6083 tmem9|OTTDARP00000023554 tmem9-001 LG_ BX544876.8 Danio rerio protein_coding KNOWN, 2058 bp
ATGTTTGTGCGTTTAGTTTTGCATTTCTGCGTGTAACATT
TTATGTATTTGTACCTCCTTATGTAATTTTATTTCCTCTA
AAATACGCAATATAGACAGGAGAAGGCCTAAACGGCGAAA
CCGGTTGTCTGCCAGCCTCTTATTAATGCGGCATAGACCA
TTTACTAACTGATTATAAGTACATTGTTTACAGTACAACC
ATCACCTTTAGCTAAACGACAAATAATTTAAATGTATTAT
TTTACAGGCGTCATGTCCTTCATTGCACAAAGTCTCCGGA
CACCAGTAATTTTCCTGGCGTTTCTTGTTCTCATAGAAGT
GGTGTCGTTTGCTTCTGCAGATAAGAGTTTTGAAGATGTG
CGTTGCAAGTGCATCTGTCCACCTTACAGAAACATCACTG
GACATATATACAAAAAGAATGTGACCCAGAAAGACTGTAA
CTGTCTGCATGTGGTGGAGCCCATGCCAGTGCCTGGTCAT
GATGTGGAGGCCTACTGTCTGCTGTGTGAGTGCAAGTATG
AAGAACGAAGCAGCAACACCATCAAGGTGACCATTATCAT
CTACTTGTCAGTGGTCGGAGCTCTTTTACTGTACATGCTA
TTCCTGCTTCTGATTGATCCTCTGATTCGCAAACATGATC
CGTACACCATGCCACTGCAGAATGAGGAGGATTCAGAGGA
TGTGAGGCCACGTGTGGACGGTGCTCGTGGAAATACAGTG
CTTGAGAGGGTGGAGGGAGCTCAGCAGCGCTGGAAGAAAC
AGGTCCAGGAGCAGCGCAAGACTGTGTTCGATCGCCACAA
GTTGCTCAGCTAAGCCTTTAGACAGAGAAAACAACAAAAT
GGCTGCACTGTCTGAGAATACTTGCATGGTGGTCTTTCAG
TTTCAGCTTTTATGACAATATAATTATCAGTGAATCTACT
GCTTGTACAATATTATTAGACTTATAATCGTACCAAGGCT
TACTTTGTTATATTAAATTCTTAAACTGAATTTGTGAAAG
CATTAAGCTGGTAAAAGAATAGTTTATCCGAAAAATAATG
TGATTTATTTATTTATTTTTAACTAAATATAGGACACTAA
TAGACATACTCAATGGAAAATACCTTGAGTGTTACTCGGG
GTGCTGTATTGTAATCTGTCAATGAAGTTACAATATTTTT
TCTTTTGCCCGAAAAAGGGTTAATTATGACCAGGCAATGC
ATGTGACTTCCATTCTTCAGCCAAAGCGTTTAGGAGATAT
TTTTTCTCCATCTATTGCAAGGTATATAATTTCTGATGGC
CAAAACTCTATATTTAGGCAGCTTTGGTTTAATCCACCTG
ACCACATTGATAAATAAGGAGTACAACTAATGATTTTAGA
AATTATTGCTTTATTTTCTTGGATTTGTGGAAATCTGCAA
GGGTATTATTATTTTGCTGGGTGAGCTATTGCTTTAACGT
ATCAATGAAAAAAATAAGCTCTTGTTTGCATCATTCCAAT
GATTACCTTTATATTTTCACCCTGAAACTTGAATATTTAA
GTGTTGTTGCTACATTGAAACTACATTGCAATGGAAGAGA
TTAAATGTAAATTTGGGAGCACTGATGTGGAGATGTACAT
AATCTAATATAAATCTGCTTATGAATGTTTAAACTGCAAT
TCAAACCGTTTTAGTTTTATTTTGTCACCAAATAATGTGA
TCATTCACTACCGTTATTTATTATTGTTATTTATTTATTA
GTGTTTGCCAGTTGATTATATATTTAAGGCACATGTCACA
AGCATATATTTTGCACATTTTAGTAACCTAATTAATAAAA
TGTGTATGTTCTTCAAAATAGTGAAGAATATAAGGCTTTA
ATTAGTTGGTTCTGTTAAACGGGATATCATACACTTTCTT
TTGAAATGACTGATACTTTTGTTGGACACTTTGATTCATA
GAAATTCAAACATACTGTTTTGTTCATCTCATCTCTTATT
TGCTGCTTTAATAACTGATTTTCCAGTATGGATCCAAAAC
ACTTGCAGCTGTTTTACCTGCTTCTGTAAAAATGCACTAA
AATATTAAAAATACAAAA

tmem9 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA tmem9-201 2058
tmem9-202 (1) 865
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem9-201 Contained in:
OTHER tmem9-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028803 (1)
  • Ensembl_Trans:ENSDART00000062403 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045338 (1) 2072bp
    GenBank:BQ077755 (1) 572bp
    CITATIONS (2)