Transcript

ppp2cb-202

ID
ZDB-TSCRIPT-090929-11219
Name
ppp2cb-202
Previous Names
  • ppp2cb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028774 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028774|OTTDARG00000022365|ZDB-GENE-040426-2487 ppp2cb|OTTDARP00000023529 ppp2cb-001 LG_ BX537303.10 Danio rerio protein_coding KNOWN, 2020 bp
GGCATGCCTTTCTGATGACGTCAGGGGCGGCGAATGCAGC
GGCCATTACACAGCGCGTTTAAGAGGAAGGTCGGAAGCGC
GGCGAGTCAACGAAAAAAATTACTAACGACAGGTAGTGGA
TCCCGTCAAACGACAGAAATCGGTTACCGCCAGCTGAAGA
TAAACACCACCGGCGATACGACGTTTCGTGTTTAATGAGC
TGATAACCGAGTGTAAGAGCAGTGGTGTGTCGCGGCGGCC
CAGCGCAGCGCGTGAGTTGCTAGTGTTACATTAAACTGGA
GTTCAGTCATCGAGCGTTCATTGCTCATTTAATTACCGAA
GAATCTGTTAAGAACACAACAGAACATTGCCGGTGATGGA
TGATAAAGCGTTTACGAAAGAATTAGACCAATGGGTCGAA
CAGCTGAACGAGTGCAAACAGCTGACCGAGAACCAAGTGA
GAACGCTCTGCGAGAAGGCTAAAGAGATTCTTACTAAGGA
GTCCAATGTACAAGAGGTGCGTTGTCCCGTTACGGTGTGC
GGAGATGTGCACGGCCAGTTTCATGACCTAATGGAGCTCT
TCAGAATTGGAGGGAAGTCACCTGACACCAACTATCTGTT
TATGGGTGACTATGTAGACAGAGGGTATTACTCAGTGGAA
ACAGTAACACTTCTTGTTGCACTAAAGGTTCGCTATCCAG
AACGCATTACGATATTGCGGGGAAACCACGAGAGCAGACA
GATCACACAAGTGTATGGTTTCTATGACGAGTGCTTGAGG
AAATATGGCAACGCAAATGTCTGGAAATACTTCACAGATC
TTTTTGATTACCTTCCCCTCACAGCCCTGGTGGATGGCCA
GATCTTCTGTCTGCATGGTGGGCTCTCTCCGTCCATAGAC
ACGCTGGATCACATTCGTGCACTGGATCGTCTGCAGGAGG
TGCCGCATGAGGGACCAATGTGTGATCTGCTGTGGTCAGA
CCCTGATGATCGCGGTGGCTGGGGAATCTCTCCACGAGGA
GCCGGTTACACCTTTGGGCAGGACATTTCAGAGACCTTCA
ACCACGCTAATGGCCTTACACTGGTGTCCCGTGCTCATCA
GCTGGTCATGGAGGGGTACAACTGGTGTCATGATAGGAAT
GTCGTCACTATCTTCAGTGCGCCAAACTACTGCTATCGCT
GTGGCAACCAGGCAGCCATTATGGAACTGGATGATACTCT
TAAATATTCGTTCCTTCAATTTGATCCTGCTCCTCGACGT
GGAGAGCCTCACGTCACCCGCCGCACCCCTGACTACTTCC
TATAAGCGAGCACTGGCCTGCCGTGAGAGACCTCTGATGA
CAAATCCAAACATGTATACATCTATTCATCTATTGTGTAT
ATAAGACGGGGGATATGTTCTGATACAACAACACTAATAC
GGACCAAAATGTGCCATACAAGCATCTAATGCCCAAATCA
GATCGCTCTGTCTCAGTACCGCTACAAAGTGTCTCGTTTT
AGCCTCTAGTGCAAATTGCCTGCTGTATACAATGAATAGA
GATGTTCCCTTCGTTCTTGAATTGTAAATTAAAAAAAGAA
ACAAAAAAACAAAACAAAAAAAAAAAAATGTTAAGTGAAT
AGCTTTCTCTCACAGTATCACAGGAATAAAACGTCCTTTA
AGTTGGCAATGCCAGGCATGTGAAAAAAAAAAAAACGGTA
ACATTTTTATACAAGTGCACAAGCTGACATCCTTTCCTGT
ATCTTCACCAAAAAATAAATAAAAATAAAATGAAAACAAA
AATGCTATTGGGAAGGAATGTTGAAAGCAAAAGACGTGCC
TCTTCCGTTTTGGGAGTGTACACACACACACACACACACC
ACACGCGCATACATACACATACATATATGGACTTTATCTG
ACTGTCCCACTTTCTCTACTCTTTCCCATTTTCTTTTCTT
TTGTGTTTCCTGTCTTCTGTGTATTTGTCAATAAGTGATT
AGACTCTTCTTTGGTGTATTTCAACTAATAAAGAACTTTT
AATCGCAAGCTACTCCCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations